Detailed Information [105188]
 

Strain Information
DGRC Number 105188
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}Bsg[NP6293] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}BsgNP6293 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 28E4
Map Viewer
Related Genes CG31605 Mcr
Original Number 6293
Chromosome 2
Comments FlyBase Insertion: P{GawB}Bsg[NP6293]

NP line. Received from the National Institute of Genetics.

Also known as PG-Gal4, P{GawB}NP6293
Balancer CyUW14
Cluster id 1103
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Embryonic Expression as, yalk.
Larval GFP gut
Larval X-gal gut, mt
Adult GFP internal abd
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-05-22
Research papers using this strain
[Please submit your publication]
Connolly KJ, O'Hare MB, Mohammed A, Aitchison KM, Anthoney NC, Taylor MJ, Stewart BA, Tuxworth RI, Tear G.
The neuronal ceroid lipofuscinosis protein Cln7 functions in the postsynaptic cell to regulate synapse development.
Sci Rep (2019) 9(1) 15592 [PubMed ID = 31666534] [RRC reference]

Chen PY, Tsai YW, Cheng YJ, Giangrande A, Chien CT.
Glial response to hypoxia in mutants of NPAS1/3 homolog Trachealess through Wg signaling to modulate synaptic bouton organization.
PLoS Genet. (2019) 15(8) e1007980 [PubMed ID = 31381576] [RRC reference]

Yadav S, Younger SH, Zhang L, Thompson-Peer KL, Li T, Jan LY, Jan YN.
Glial ensheathment of the somatodendritic compartment regulates sensory neuron structure and activity.
Proc. Natl. Acad. Sci. U.S.A. (2019) 116(11) 5126-5134 [PubMed ID = 30804200] [RRC reference]

Okamoto N, Yamanaka N.
Steroid Hormone Entry into the Brain Requires a Membrane Transporter in Drosophila.
Curr. Biol. (2019) [PubMed ID = 31928869] [RRC reference]

Seabrooke S, O'Donnell MJ.
Oatp58Dc contributes to blood-brain barrier function by excluding organic anions from the Drosophila brain.
Am. J. Physiol., Cell Physiol. (2013) 305(5) C558-67 [PubMed ID = 23804204] [RRC reference]

Avet-Rochex A, Kaul AK, Gatt AP, McNeill H, Bateman JM.
Concerted control of gliogenesis by InR/TOR and FGF signalling in the Drosophila post-embryonic brain.
Development (2012) 139(15) 2763-72 [PubMed ID = 22745312] [RRC reference]

Stratoulias V, Heino TI.
MANF silencing, immunity induction or autophagy trigger an unusual cell type in metamorphosing Drosophila brain.
Cell. Mol. Life Sci. (2015) 72(10) 1989-2004 [PubMed ID = 25511196] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np46805_0912
Strand Minus
Insertion Point 8080580
Chromosome Band 2L
Flanking Sequence
GTGNTCTTCGGNAGCTTCGGCTTCGACGGGACCCCTTATGTTATTTATNATGCACATGAC
CACGGACGAGAGTAGCCGCCTTCGCTGCGGCAGCGACGTCGACGCACAGTGATTTGGGTT
CAGTTTGACATACACTTGTCAGCTTATCTAAATAGTTCGGCCGTTATCTTGACCAGACCG
ATTACGAGTACTGNACAAAATGGCGAAAAATAAATCGAGTTTAAACGACATTTTTTCATT
ATACAGGAATCTTTANGAATTTGAAATCACCTGNTTTATTTAAAACAAAATGCAGAAGCT
AGGNCTGACTTCAAGCTACTTAATTAGCTTGAAAACTTAAAAAAAAAATTTTTAAAANCN
TTAAATTGGGGTATTTAATCAAANTTTTTGCTCTTTGGGAAACCCTTATTTTTACAGGTC
AAANANGGGAATTTTCCCCAAATTTGNCCGGGAATTACACANGNGCCCTTGNGGCCCCCG
NATNGGGNCCCCGNAAAAAACCCCCTCCCNTTTTNTTTAACCTTTTTTTTNTCCNAACCC
TTNTAAAAGCCCCCTTTAAANGGGACCCAGTTTTAAAANANAATTTGNGANTTCCGGGCC
CCTTGGGTTTCCNANCNAAAAATTNCCCCNAGGGGGCCCNANGNTCTGGGGNGGTNTTTT
CCCCNCCCCATTTTTTTTGGGCGGTCNGGGGGAATTCCCTTTGNGNGGNAGCCCCCGCGC
CCAAAAAAACCCCNTTTTTGNGGGGGGGGCCCNTTTTCAGGGGNNGGGGGGAGCCCCNCC
CCNCANTNNTTTTCCCTTTTttaaanccaannaaatcccngngagggggccccccngggg
cnaaaaaaaccnccgngttngggggggtntattaganggggggggggggnaaaaannaaa
annaanaggggtnngngcccttgggaaacccccttcccggnggagggggccccttttttt
ggggnccaagngggngggatagcncggcccnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnn

CLOSE