Detailed Information [105240]

Strain Information
DGRC Number 105240
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP6520 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}NP6520 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 73B5
Map Viewer
Related Genes Galpha73B Baldspot snRNA:U12:73B
Original Number 6520
Chromosome 3
Comments NP line. Received from the National Institute of Genetics.
Balancer TM6UW23-1
Cluster id 1937
General Information NP_lines
Embryonic Expression weak
Larval GFP fb
Larval X-gal sg, fb
Adult GFP abd
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Okamoto N, Nishimura T.
Signaling from Glia and Cholinergic Neurons Controls Nutrient-Dependent Production of an Insulin-like Peptide for Drosophila Body Growth.
Dev. Cell (2015) 35(3) 295-310 [PubMed ID = 26555050] [RRC reference]

Omoto JJ, Yogi P, Hartenstein V.
Origin and development of neuropil glia of the Drosophila larval and adult brain: Two distinct glial populations derived from separate progenitors.
Dev. Biol. (2015) 404(2) 2-20 [PubMed ID = 25779704] [RRC reference]

Stratoulias V, Heino TI.
MANF silencing, immunity induction or autophagy trigger an unusual cell type in metamorphosing Drosophila brain.
Cell. Mol. Life Sci. (2015) 72(10) 1989-2004 [PubMed ID = 25511196] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np46175_0912
Flanking Sequence
ATTNTTTGTNTCTTCGGAAGCTTCGGCTNTCGACGGGACCCCTTATGTTATTTATCATGG
GTAGATCGAAGAATACATAAGAGAGAACCGTCGCCAAAGAACCCATTATTGTTGGGGTCC
GTTTTCAGGAAGGGCAAGCCATCCGACATGTCATCCTCTTCAGACCAATCAAATCCATGA
AGAGCATCCCTGGGCATAAAATCCAACGGAATTGTGGAGTTATCATGATGAGCTGCCGAG
TCAATCGATACAGTCAACTGTCTTTGACCTTTTGTTACTACTCTCCTTCCGATGATGATG
GTCGCACTTATTCTATGCTGTCTCAAATGTTAGANGCATATCAGTCTCCACTGAAGCCAA
TCTTNTNTGGANNNNGGTNCTTCCCCTTTTCCCCNNTTTTTTNCCTTTTNNNNNCNNNCC
CCTCNNCTTTTNCNTTCCNTTTNTTNCTCTCNNGNTNCNCNTTTNTTNNNTNTCCTTTCC
TTNNACNNNNCTCNTNCCATNTTTTNTNNNTTNTTCCNCATGGTANNCTTTNNTNTCTTT
CCCNCCCNNTNTNANTTTCTNTCNTTTCCNTCCCNTTTCGTCNNCNNCNGATNNNNTTCC
NTCGNNTNCNNNNNGNTTCNNATCCNTTTCGNANATTTTTTCTCNNCNTTCNATCTCNNN
CATTCGTNATCNTAATATCCGTTTTTCATTTNCCGGCCCTTNTTNCGNNTATNGCCGTTT
NCGNANNNTTTCCNNCCNGGGTGNCGNACCNCGCGANTGTNGNTGCNNNTTCTANGNGNN
NNTNACTNNNNATNCNCNGCtagcnccttncctcttntcttttgacctttcntnccnccc
antctnngctccncnntgcccnccccngtnttaccncntatacatancnccnncccncgt
gatgnccttcncgtntttanccannnccacnttttnnncccccnnttnntantcctntat
cctttnnanccnccntttnntttcccccntanagtctgntnntgntnncattacnnantt
ncccntccccattat

Library Name / Clone Name np / np66373_0309
Strand Plus
Insertion Point 16603022
Chromosome Band 3L
Flanking Sequence
anccttnctgcgcacttattgcaagtcatacgttaagtggatgtctcttgccgacgggac
caccttatgttatttcatcatgATCCTCTAGCTAGTAGCTTTGGGTACTNGCNAATTATN
AAAANTAAAACTTNANAAATAGATTTCGTNTAATTAATATTATGAGTTAATTCAAACCCC
ACGGACATGCTAAGGGTTAATNAACAATNATATCGGTGTCTAACTNATACTGCAATANAN
AAGATGCNTTNCGTGNGNNGTGANGCACATCATGTNNAAACAAACNAATACTTGGAACTG
TATAAAACAAAGNNNCTAAGCAANTNTTAAGNGTNAATATGCCCAATTAGNGNGNNTTAN
CAACCAAANGGGNNAAGTCATTAGAAGCNNNCNNNNNTATAAANAAACTNAAANNNNANN
CANNGGNNAAGNNAACANNNNANNNNNNNNNNNNGNNNNNNNNNNNNNNNNAANNNNNNN
GNNNNCNNNANCTNNAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncn


CLOSE