Detailed Information [105355]
 

Strain Information
DGRC Number 105355
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}CG17323[NP7067] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}CG17323NP7067 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 37B1
Map Viewer
Related Genes BEST:LD25345 CG17323 BEST:GH06505
Original Number 7067
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP7067

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1236
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Embryonic Expression weak
Larval GFP fb
Larval X-gal lateral cells, mt, fb
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Lin TY, Luo J, Shinomiya K, Ting CY, Lu Z, Meinertzhagen IA, Lee CH.
Mapping chromatic pathways in the Drosophila visual system.
J Comp Neurol (2016) 524(2) 213-27 [PubMed ID = 26179639] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np33765_0907
Flanking Sequence
AATTTTGTGNTCTTCGGAAGCTTCGGCTNTCGACGGGACCCCTTATGTTATTTATCATGC
TGNCGACNGCGACTGACTAAATTNNNAGACTNCNTNCGANTGANANGCNTNNANGCCNAN
GCTAGNGNNNNAAGNCGANANTGCTNAGNCANCGNNNGGNNGCGACATTGATTNGGCACN
NGAANTGTGNANTCCNNATCGTGGNTGNCGCGTCCCTANNNAGGGNATGCCATCCTNTAA
NCTANTGNTTTTNANCCAATCCGAGGCATNGAATTANCAANCNTGGGGGATAATATTGAG
GAAATTTNAGGGGCNAGCTTTGATTAGCTGNCNTNGGAATATGGGCAGTGCAACCGAAGT
TGACCTGGGNAAACCACCNCCCNTTGGANCCGNCGGACTANTTNTTGCNTNAGGAACAAA
TGNTGGAGGNCTNTTTTTNTCCATGNAAGCAATCTTTCTTGGGGGTTTCCCATGCCNGGN
TTTTANACCTGNTTTANACCTCNGGGGTTTGGACCTTGGANTTTNAACCTNCACCTGAAG
GCGCTGAAACCANCGGANTNNTCNGCGGTTCGNCCACCCAATTGGAACCCCAAACGGGAA
AACCNGAACCCAAAATNNTTTCAAAACNCCCTAGGGGGNNANTNGGCGTCCAACCNNCAN
CNTTGGGGAAGNGTTNGCCCCAAGGNNAGGGCNANNTTTTTTTNNCCCCTGNCAAGGNGG
AAGNGGGGNGGCACCAAAANNTTTTGGGGCNGGTANAAANCNNTTTNANTNGCNCCCAAA
CNAAGGGGCCNCANGNGNNGgncttnnttttcccntcccacaattgggggnggggggctc
ccntaaaaangnnnnttnggggcnggggggccctctttgaaaaanttncggggccnggnn
nttttccttggagggcnngnccccngttaatccaaaaaaaaccggnntntaaannnaaat
ngag

Library Name / Clone Name np / np63153_0309
Strand Plus
Insertion Point 18801666
Chromosome Band 2L
Flanking Sequence
cttttcactgcgcacttattgcaagcatacgttaagtggatgtctcntgccgacgggtac
cnccttatgttatttcatcatgGTCGGNAGNCTTACAAGTAANNAAGAGAGGAAGGNGAG
CCTCAACCCNNNCGNNNTTCCAAAGNGACGACTGCGATGTCTTTATGTATAAGNTTGTGT
GNGTGNATCCAGTTCAANGGCTCAATTGAATTCCNGNTGAAAGACCCTCACCAGGCGANA
ATTGTGAATATATTANGCGGGTGCAGTGCCGNTTGNGATGCAATTGCAGNNGCTTTTGNT
GNGCTNGNGNNNTCCTTTGCTGNTTTCGNCCGCATTCTTTACATAATNNNCCTGCATNNC
TNGNATNCGNNACATGCNCATTGNCGNCCACCGNCCNNNTCANNGNCNNTNGNNNNNACT
NAAAANNCNNNANCCNNNNNNNANCNNNNNNNNNGNNNNTGNNCNNNGNNCNNNNNNNNG
NNNNNNNNNNTTANNNNNNNCNNTNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNNNTTTN
TNNNNNNCNNNNTNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
TNTTNNNNNNNNNNNNNNNNTNNNNNNNNNNNCNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNCNCNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nt

CLOSE