Detailed Information [105401]
 

Strain Information
DGRC Number 105401
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}CG15445[NP7226] / FM7c
Genotype y* w* P{w+mW.hs=GawB}CG15445NP7226 / FM7c
Break points/Insertion Site 19F1
Map Viewer
Related Genes CG1501 CG15445 CG32516
Original Number 7226
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP7226

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 490
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression a small # of cells
Larval X-gal sg
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Lin TY, Luo J, Shinomiya K, Ting CY, Lu Z, Meinertzhagen IA, Lee CH.
Mapping chromatic pathways in the Drosophila visual system.
J Comp Neurol (2016) 524(2) 213-27 [PubMed ID = 26179639] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np06475_0711
Flanking Sequence
GGGGNANGTNNTTGTNANTTNNCTTGTGNNGANTCNACCGGNGNGTCAAAAACCCCGNCC
NACTTGGGNTGNCGGTAAGACTCCCGGCTATCGTACGGGNACCACCTTNTTTTATTTCAT
CATGAACCAGGAACATCACATGNACTCGTAAATAGTAAATATCTAGAGCTTGCCCGATCG
AAGAATACATAAGAGAGAACCGTCGCCAAAGAACCCATTATTGTTGGGGTCCGTTTTCAG
GAAGGGCAAGCCATNNTTTATGTCATCCTCTTCAGACCAATCAAATCCATGAAGNGNNNC
CCTGGGCATAAAATCCAACGGAATTGTGGAGTTATCATGATGAGCTGCCGAGTCAATCGA
TACAGTCAACTGTCTTTGACCTTTGTTACTACTCTCTTCCGATGATGATGTCGCACTTAT
TCTATGCTGTCTCAATGTTAGAGGCATATCAGTCTCCACTGAAGCCATCNTNTTNTGGGN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np55243_0309
Strand Minus
Insertion Point 20789807
Chromosome Band X
Flanking Sequence
tcttttcctgcgcacttattgcaagtcatacgttaagtggatgtctcttgccgacgggac
caccttatgttatttcatcatgTTCTGGTTCTTCTTCTTCCTTGCACATGTGTTTCTACA
CGAAACAACAAAGAACGATGCGCAGTCGTTGATAATCGCGGGGTTGGGTGCAGTGGAGTA
GACTTTAATTTTGGGCGGGTGACAAATAAGAACTATTTACGGAAATTTATTTAATGTGAA
CTGTGCTGCGTCTTCGTATGGGATAAGCTCTGCCTGGGGGAATCACCGCAATTGGGTNTT
TTTTGTNGNNTGACACAACAACTGNAACTCGATAGCTATCGGNTCTTGCAGNACTNGGNC
ATNTGTCAGNCACAGNGAAACGCTNGCAAAANCTGACTGACATGAACGTTCTGCCCGNTN
ATAGNCAAAGNNTTNAAAANTGGGNTTTTTATAAAAACNCNTTGGCAAACACANNTGNGC
NNGGNGNNNNATATNANATNANNNNNTNTACCCNNTAACGCAAGAAACTNATATTTTANN
TTNACCGNNAGNNCGGGTGGNGCNCTTACTANTTANNAANNANNNGGTTGNGGGNAANNN
TNTNTNNNNNGNNNANNGNCNACNTTAAANNNNGNACNGNGTNNNNNTTNAAANNNAAAA
NNTTTTTTNGGNNAAAAAANANCNAANNNCCNCNTTNNNNAANAAANNTGNTGNNNNNAA
ATGGGNNNNNGNNNNNNAANTNGCCNCCNNNTNANNNTTNNNNNGNNANNNCTTNNNNNN
AAAAAANNNNTNNNNNTNNAaaacccntnnnnannannnnannnnnnnnnnnnttnnnnn
naatntntnnnggncncttnnnatnnnnnncnnnnnnnncn

CLOSE