Detailed Information [105442]
 

Strain Information
DGRC Number 105442
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP7379 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP7379 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 37F1
Map Viewer
Related Genes CG10337 TepIV
Original Number 7379
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP7379

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1245
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression sg
Larval GFP sg
Larval X-gal gut (mg?)
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Blanco-Obregon D, Katz MJ, Durrieu L, Gandara L, Wappner P.
Context-specific functions of Notch in Drosophila blood cell progenitors.
Dev Biol (2020) 462(1) 101-115 [PubMed ID = 32243888] [RRC reference]

Tokusumi T, Tokusumi Y, Schulz RA.
The mir-7 and bag of marbles genes regulate Hedgehog pathway signaling in blood cell progenitors in Drosophila larval lymph glands.
Genesis (2018) 56(5) e23210 [PubMed ID = 29663653] [RRC reference]

Sharma SK, Ghosh S, Geetha AR, Mandal S, Mandal L.
Cell Adhesion-Mediated Actomyosin Assembly Regulates the Activity of Cubitus Interruptus for Hematopoietic Progenitor Maintenance in Drosophila.
Genetics (2019) 212(4) 1279-1300 [PubMed ID = 31138608] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np06925_0711
Strand Plus
Insertion Point 19526381
Chromosome Band 2L
Flanking Sequence
GGGGGNANGNGNGTGTGTAGTTTNTTTGTNNGGANNCANACGGGNGTTCAATAAACCCGT
NACTTGGGNCTNNCGGTAAAGACTCCCGGCTATCGACGGGNACCACCTTTTTTTATTTCA
TCATGAGAGCGACATCTAACAAAACAACAACAGCTGACTCAGTAGAGAGCAGGAAAGAGT
TTTCGATATATATGTACACAACGCCTAGTCAGTTGGTCTCCGTATTTCGATTTAGGAGGC
AGTTCCGTTAACANTNNAAATCAACAAGTCCAAATAATATTGCACGCACGTNAGGGGCCA
CACGACAAAAACATAAATATTTGTATTCAATTCATATATTGGGATTTTACGCGAGATCGA
AGAATACATAAGAGAGAACCGTCGCCAAAGAACCCATTATTGTTGGGGTCCGTTTTCAGG
AAGGGCAAGCCATCCGACATGTCATCCTCTTCAGACCAATCAAATCCATGAAGAGCATCC
CTGGGCATAAAATCCAACGGAATTGTGGAGTTATCATGATGAGCTGCCGAGTCAATCGAT
ACAGTCAACTGTCTTTGACCTTTGTTACTACTCTCTTCCGATGATGATGTCGCACTTATT
CTATGCTGTCTCAATGTTAGAGGCATATCAGTCTCCACTGAGCATNNNNNNTNGGGGGNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGNNNNNN
NNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

CLOSE