Detailed Information [105481]
 

Strain Information
DGRC Number 105481
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}SNF4Agamma[NP7476] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}SNF4AγNP7476 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 93C4
Map Viewer
Related Genes SNF4Agamma CG7000
Original Number 7476
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP7476

NP line. Received from the National Institute of Genetics.

Also known as NP7476-Gal4
Balancer TM6UW23-1
Cluster id 1573
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Larval X-gal sg, mg
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Lin TY, Luo J, Shinomiya K, Ting CY, Lu Z, Meinertzhagen IA, Lee CH.
Mapping chromatic pathways in the Drosophila visual system.
J Comp Neurol (2016) 524(2) 213-27 [PubMed ID = 26179639] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np41595_0907
Strand Plus
Insertion Point 17014546
Chromosome Band 3R
Flanking Sequence
nttntttggngcactgannttaagtgtatacttcggtaagcttcggctatcgacgggacc
accttatgttatttcatcatgCAGCTACAGTTATACACCGAAGTGCGGAGCACATGGGCG
GACCGACCAACCGACCGCTTTTAGTTCGATTCCAACTGCCGGCAGAGTCGGATGCTCAGC
CACGTGACTTTTGAATTTCGATCGAAGAATACATAAGAGAGAACCGNNGCCAAAGAACCC
ATTATTGTGTGGGGTCCGTTTTCAGGAAGGGCAAGCCATCCNACATGTCATNCTCTTCAG
ACCAATCAAATCCATGAAGAGCATCCCTGGGCATAAAATCCAACGGAATTGTGGAGTTAT
CATGATGAGCTGCCGAGTCAATCGATACAGNCAACTGNCTTTGACCTTTGTTACTACTCT
CTTCCGATGATGATGTCGCACTTATTCTATGCTGTCTCAATGTTAGAGGCATATCAGNCT
CCACTGAAGCATCTTNTTTTTTGGGNGGNNNNNNNNNCNTNNGNACNANNTNNNNTNNCN
ATNANGNANNNNNNACNTATTTNTATGGCTGNNTNAATGNTNAGAGGGATANANNNNTTN
CNCTGAAGCCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnaaaaaaaaaaaan

CLOSE