Detailed Information [112001]
Strain Information
DGRC Number 112001
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP0001 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype w*; P{w+mW.hs=GawB}NP0001 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 31F4
Map Viewer
Related Genes CG13144 CG6094 Myo31DF
Original Number 1
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP0001

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1151
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression a small # of cells, hg
Larval GFP gut
Larval X-gal gut
Adult GFP abdomen
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Dasari SK, Schejter E, Bialik S, Shkedy A, Levin-Salomon V, Levin-Zaidman S, Kimchi A.
Death by over-eating: The Gaucher disease associated gene GBA1, identified in a screen for mediators of autophagic cell death, is necessary for developmental cell death in Drosophila midgut.
Cell Cycle (2017) 16(21) 2003-2010 [PubMed ID = 28933588] [RRC reference]

Kurz CL, Charroux B, Chaduli D, Viallat-Lieutaud A, Royet J.
Peptidoglycan sensing by octopaminergic neurons modulates Drosophila oviposition.
Elife (2017) 6 [PubMed ID = 28264763] [RRC reference]

Anding AL, Wang C, Chang TK, Sliter DA, Powers CM, Hofmann K, Youle RJ, Baehrecke EH.
Vps13D Encodes a Ubiquitin-Binding Protein that Is Required for the Regulation of Mitochondrial Size and Clearance.
Curr. Biol. (2018) 28(2) 287-295.e6 [PubMed ID = 29307555] [RRC reference]

Xu T, Nicolson S, Denton D, Kumar S.
Distinct requirements of Autophagy-related genes in programmed cell death.
Cell Death Differ. (2015) 22(11) 1792-802 [PubMed ID = 25882046] [RRC reference]

Bader CA, Shandala T, Ng YS, Johnson IR, Brooks DA.
Atg9 is required for intraluminal vesicles in amphisomes and autolysosomes.
Biol Open (2015) 4(11) 1345-55 [PubMed ID = 26353861] [RRC reference]

Pendse J, Ramachandran PV, Na J, Narisu N, Fink JL, Cagan RL, Collins FS, Baranski TJ.
A Drosophila functional evaluation of candidates from human genome-wide association studies of type?2?diabetes and related metabolic traits identifies tissue-specific roles for dHHEX.
BMC Genomics (2013) 14 136 [PubMed ID = 23445342] [RRC reference]

Denton D, Chang TK, Nicolson S, Shravage B, Simin R, Baehrecke EH, Kumar S.
Relationship between growth arrest and autophagy in midgut programmed cell death in Drosophila.
Cell Death Differ. (2012) 19(8) 1299-307 [PubMed ID = 22555456] [RRC reference]

Okamoto N, Nishimura T.
Signaling from Glia and Cholinergic Neurons Controls Nutrient-Dependent Production of an Insulin-like Peptide for Drosophila Body Growth.
Dev. Cell (2015) 35(3) 295-310 [PubMed ID = 26555050] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request
---

Library & Clone Information
Library Name / Clone Name np / np51725_0227
Strand Minus
Insertion Point 10499195
Chromosome Band 2L
Flanking Sequence
ggtttttggtgcactgaccttaagtgtatacttcggtaagcttcggctatcgacgggacc
accttatgttatttcatcatgGTCTGACCACAGTCCCTCTGCAACTTTCATTGAATGCGG
TCGAGTGCGGTTGTGCGACGGCCGATTGTTGTTATTAATCCGCCGCAAACGAAACTGAAT
CCAGGTGGGCACTCACACCGATCNAAGAATACATANGAGAGAACCGTNNNCAANGAACCC
ATTATTGNTGGGGTNCGTNTTCAGGAAGGGCAAGCCATCCGACATGTGATCCTCTTNAGA
CCAATCAAATCCATGAAGAGCATNCNTGGGCATAAAATCCAACGGAATTGTGGAGTTATC
ATGATGAGCTGCCGAGTCAATCGATACAGTCAACTGTCTTTGACCTTTGTTACTACTCTC
TTCCGATGATGATGTCGCACTTATTCTATGCTGTCTCAATGTTAGAGGCATATCAGTCTC
CACTGAAGCCATCTTATTCTGGATGACNAGCTGNCGAGGNANATGATNCACTCANCTGNT
GCTGACCTNAGGTACTACTCTTTTCNGATGATGATGTAGCNCTTATTTTATGCTGNCTNA
ATGNTAGAGGCATATCANNNTNCACTGAAGCCAATNTNNTNTGNNNNNNNNTNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnntn

Image Files
Disc

d1 (->Large)

CLOSE