Detailed Information [112054]
Strain Information
DGRC Number 112054
Genotype with FlyBase Link w[*] P{w[+mW.hs]=GawB}Pfrx[NP0127] / FM7c
Genotype w* P{w+mW.hs=GawB}PfrxNP0127 / FM7c
Break points/Insertion Site 18C8
Map Viewer
Related Genes CG14199 Pfrx
Original Number 127
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP0127

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 451
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression a small # of cells
Larval GFP gut
Larval X-gal sg, gut, fb
Adult GFP abdomen
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request
---

Library & Clone Information
Library Name / Clone Name np / np04055_0711
Strand Plus
Insertion Point 19229268
Chromosome Band X
Flanking Sequence
gtcaacgtgcactgnanttaagtgtatacttcggtaagcttcggctatcgacgggaccac
cttatgttatttcatcatgGTCCGGGGCTCCGCGCACTTGACTCGCTCCGCTTTGCGCAT
TTTGCTCATTTCGATTTTGCCAAGCGACGTGTACGGAACTGAACTGAACCGAACTGAATT
GATACGCGGTTCGGCGGATTCGCTTTGTACTTTCGTTTCTTGTGCTGTTCTGTGTGCTGT
GCGCCCCCACAGGAATATCGAGTCAAAATCAAGTCAAAATACGAGAATTCGTGTGTTTTT
TCTCTGTTCTTTTTTTTTAACTATTTTGNTTTTTTTTATTATTTGCGTACTAANAAATTA
GCGTTGTAGCAAAAGTAAATCTGTGATTTTTTTTTCCGTTCTGTTTTGTTTACCTTNGGG
CTTGNAACGATTCAAAACAAATAGCAAATCGNGTGATTAAANGAATAAAGNGGGCCANAA
GTCGGGGGGTGCGGGCNCTCTGCACANTTGCTTGNATTCAAGGGCGCGCCCTGCNCTGNT
TTGNATTCCAGGGGCAAAGGGCTNAATTNGANGGNAACGGGNCCGNCTTCTACCGCCNGC
TTAAAAACCCCNTGATNGNAGAAAANCATAAGAANANAACCCGCCGCCCAAAAAACCCNT
TTNTTGNNNGGGGGNCCGTTTTCAGGGAAGGNNAGANCCNTTNCNACATNGTATNCCTTT
TAGANCNANTCAAATCCATGAAAGAGCCTTCCCTGGGGNATAAAAATCCNACGGNAATTG
GGGNGNNTTTAATGATAGANgctgccgaggtaatccgatacaganaaatggtcntttgac
ctttgntactaccttctttccaagaaganggcgcccnttatttttangctggctnaaggg
tagggcataaagntccnnnntnnnnnntnnnntnnnnnnnnnnnnnnnnnnnnnnntnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnna

CLOSE