Detailed Information [112055]
Strain Information
DGRC Number 112055
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}bun[NP0132] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype w*; P{w+mW.hs=GawB}bunNP0132 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 33E7
Map Viewer
Related Genes CG31858 bun
Original Number 132
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP0132

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1167
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression a small # of cells
Larval GFP fb, gut
Larval X-gal sg, gut, fb, mt
Adult GFP abdomen
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request
---

Library & Clone Information
Library Name / Clone Name np / np04075_0711
Strand Minus
Insertion Point 12473240
Chromosome Band 2L
Flanking Sequence
tgtcaacgtgcactgnaattaagtgtatacttcggtaagcttcggctatcgacgggaccc
cttatgttatttcatcatgGTTTCGCTCTCTTTGTCTGAAATTCAGCTAAAAAGCTTTTG
AAAAAGCAGCCATGTTGCTTTTTTATCGTCCATGTGTGTGTGTGGGTGTCTTGTCTGTTG
GTATCTCACTCTCTCTCCTCTCATAAATTCACTGATTGGAAAGATTCGTTCCTCTGTTTT
TTTTTTTTTNGGGTNCACNNNCCCTTTTTAAANGGTNNANANGGNNGGGNGGNNNATTTT
ANAGNCTTTTNGGNGGGCCTNAANCGGGGNNTTGCATTCCCTNCTTGNGAAAAAAAGGGG
NCCCNAAAAAAAGANCGGAGAANCCANAAGNNAAACCCNCCCCNAAGAAACCCTATATTN
GGGGGGGCCCCTTTTAGAGNNGGGNACCCCTCCCNNNANNTNTTCCTTTTNANNCNAATA
NATACCCNGGAGNGCCTCCCGGGGNANAAAACCCNNGGGATTTGGGGGNNTTNNAGGAGA
GAGCGCGCGCGAGAATTCGATNCNNNNAAAGNGGTTTNGCCCCTTNGGACCCCCCTNTNC
CCGAGAGANGGGGGNNCCCCCTTTNTTTTANCGCNGGGCTAAANGGGNNGGGGNANAANA
NCNCCCCNCGCCCCCTNNNNNTNNNNNNGNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNCNNNNN
NNCNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Disc

d1 (->Large)

CLOSE