Detailed Information [112056]
Strain Information
DGRC Number 112056
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP0140 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype w*; P{w+mW.hs=GawB}NP0140 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 66A2; ---; ---
Map Viewer
Related Genes CG17429 CG40064 CG40412 CG40416 CG7548 CG8539 F-element{}949
Original Number 140
Chromosome 2
Comments NP line. Received from the National Institute of Genetics.
Balancer CyUW14
Cluster id 1812 2138 2146
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Embryonic Expression weak
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request
---

Library & Clone Information
Library Name / Clone Name np / np05135_0711
Strand Minus
Insertion Point 7145123
Chromosome Band U
Flanking Sequence
cttcttgggtgcantgccttttnttgtntacttncggtaagncttcggctatcgacgggn
accaccttntgttatttcatcatgGGTCTGACTAAGTCAGCGAAAGCAAAACCGCTAGCA
ATAAACGGTACTGCTGCACTGCCAGCAAAACAAAACGAAAACGTAAACAAAAAAGCTGGG
TCGACCTGGCAGACTGGAATGGACCGCTACATTACAATAAANCNAAAGCTCAGCCCGGAA
AATTCAGATTTGGGAAACAAGCCGAAAAATACACGCGACAACTCTACCTTgatcgaagaa
tacataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagg
gcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgg
gcataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatacag
tcaactgtctttgacctttgttactactctcttccgatgatgatgtcgcacttattctat
gctgtctcaatgttagaggcatatcagtctccactgagcatnnnnnnnnnnnnngnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np54853_0309
Strand Minus
Insertion Point 7458834
Chromosome Band 3L
Flanking Sequence
gnnnggngnggngngnccgcccgggnagggnggaangtttttggnnnggaccnatngggg
gcataanccgcnttngacgttagtggaagcctcttgccgacgggnaccaccttatgttat
ttcatcatgGTCAGACCGGGAGCGGGTGCAGCCGATGACGAGGCAGAGCGGGCTGCCGGT
CCCTCTCCAGCTGNTGNNGNTGGAGGTAGCGGGGCTTCTGNTGGAGCCAATAGAGCGGGA
GAGCAGGAGCGCGCTCTTTCTNGATTNGTTGGNAGAAGAAGGGNNCCTGGGGGGGGGGGG
ANNGACCGNNCGANGNNNGCGNNNGGGANNGNNGGNGAGACGNAGGAGAAGNNCGCGNNG
NNGNGCNGAANNGAGAGNNGGNGNNNGNNANGCNNGNGCNGACGCNGGGNGCGAGNGNNA
NNNNNGNCNNANNNNNNNNNNNNNNNNGANNNNNNNNNNNNNNGNNNNNNNNNGNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
cn

Library Name / Clone Name np / np70025_0810
Strand Plus
Insertion Point 6353977
Chromosome Band U
Flanking Sequence
gtcaacgtgcactgnanttagtgtatacttcggtagcttcggctatcgacgggnaccacc
ttatgttatttcatcatgGGTCTGACTAAGTCAGCGAAAGCAAAACCGCTAGCAATAAAC
GGTACTGCTGCACTGCCAGCAAAACAAAACGAAAACGTAAACAAAAAAGCTGGGTCGACC
TGGCAGACTGGAATGGACCGCTACATTACAATAAAGCGAAAGCTCAGCCCGGAAAATTCA
GATTTGGGAAACAAGCCGAAAAATACACGCGACAACTCTACCTTgatcgaagaatacata
agagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggcaagc
catccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggcataa
aatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatacagtcaact
gtctttgacctttgttactactctcttccgatgatgatgtcgcacttattctatgctgtc
tcaatgttagaggcatatcagtctcactagctccnntnnnnnnggggggnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnncannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

CLOSE