Detailed Information [112058]
Strain Information
DGRC Number 112058
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP0142 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype w*; P{w+mW.hs=GawB}NP0142 / CyO, P{w-=UAS-lacZ.UW14}UW14
Original Number 142
Chromosome 2
Comments NP line. Received from the National Institute of Genetics.
Balancer CyUW14
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality semi lethal
Embryonic Expression sg
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request
---

Library & Clone Information
Library Name / Clone Name np / np04095_0711
Flanking Sequence
ttaacgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccacc
ttatgttatttcatcatgATCNAAGAATACATAAGAGAGAACCGTNGCCAAAGAACCCAT
TATTGTTGGGGTCCGTTTTCAGGAAGGGCAAGCCATCCGACATGTCATCCTNTTCAGACC
AATCAAATCCATGAAGAGCATCCCTGGGCATAAAATCCAANGGAATTGTGGAGTTATCAT
GATGAGCTGCCGAGTCAATCGATACANTCAACTGTCTTTGACCTTTGNTACTACTCTCTT
CCGATGATGATGTCGCACTTATTCTATGCTGTCTCAATGTTAGAGGCATATCAGTCTCCA
CTGAAGCCAATCTTATCTGGGNCCGTNTTTANGAAGGGCAAGCCATCCNACATGTNATNC
TNTTNANACCAATNAAATNCATGAAGAGCNTNCNNGGGCATAAAAATNCAACGGNATTTG
GGGAGNTATANTGNNNANCTNNCCGAGNNAATNGNNACANNNAACTNGNNTNTGNNCCTT
NGNNACTACCCNTNTTCNNNGANGANGNNCCNCTTATTCTATGCTGNNTNANGGNNNGAN
GGCNTANNAANNNNCCNNTTGNANNCNATNNTTTNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNAnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnannnnnnnnnnnnnnnannnnnnnnn
nnnnnagnnnnnnnannnngagnnnannnaagnnngnnnnnnnnannnnnnaannnnnnn
nagnagnannnnnnagnannnnnnaanaagn

Library Name / Clone Name np / np54523_0309
Flanking Sequence
cttttttgggggaaaaaccgcaagtcatacgttaagtggatgtctcttgccgacgggacc
accttatgttatttcatcatgCATCGGATTGTGCTTCTTGAAAAAGCACGATCAGATNCG
NGGAACGGNCGNATAGGCCACTAGTGGATCTGGATCCTCTAGCTAGAGCTTTGANAACCA
ACAGGCCATATTATNGNTGCGCAAANNCGTTTGGCTATTTTTTNTTAACTACAANGCCCT
TTACAANCTCAGNTTAATNTACATCNCCTGTGAGGNCTTCGNAANCTAAGNACACTNTAA
GACATTAAAATATAAAAGGGTGGGGGGGGGGGGTCNTNTTTTNNTCTNTCNNTNTTTNTT
TTTTTTCTCTTNTNTNTNNCNNNTTNTCNTAANTNTTNTTNCNNTTNNCTTAACNNNTTN
NGAACTNANNTCAANTCTNCNAANNTTNNNNTCCCNCCNNTCAANNAAAAACCTTTNTTC
TNTNCCCNTCCCACCNNNTTCTCGTTNCCCNNNNTTCGCTTTGTNNTTCGNTTCTNTNAA
ANGGTNNCCNCNNGTTTNNCCCNCGCGTNCCNNNGGANCNGACCCNNTTCTNCGTNTNAT
NNAAANATTNTTAAAACNTGCNTTNNTACNGTNATCCTNTNCNCATNGNNGNNCGNCAGT
TCNCNTTTCNCCTTNCGGGNNNNCNTNTTNNAACGNTTAANCCCCTTTTTTNNNNGTGNC
NCCCCCNNTCNNATNNCGCNNATCTNATNNNGCTCNNCTAGATNNNCANNCNNANATACG
TNTCTNCGNCCNNTNNNCNGccctccnncaacactctnccttttnatanccntcncccnt
tttanttgacntnaattnctcnnnncccatnantntcacgnccnactnnnncntntanca
tncnccgancatatnctanctncnntccngngccntccttntttcnaacncgcnccnngc
ntattacngtgtcncnnttnccanacgtcnnataataagannncantnnnactcnngaan
nnacnnnag

Image Files
Disc

d1 (->Large)

d2 (->Large)

CLOSE