Detailed Information [112060]
Strain Information
DGRC Number 112060
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP0145 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype w*; P{w+mW.hs=GawB}NP0145 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 85A2
Map Viewer
Related Genes Or85b CG31369
Original Number 145
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP0145

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1385
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression AS, cns midline, pns subset (ch)
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request
---

Library & Clone Information
Library Name / Clone Name np / np05145_0711
Strand Minus
Insertion Point 4303391
Chromosome Band 3R
Flanking Sequence
attttagcgtgcactgnaatttaattgtatacttncggtaagncttcggctatcgacggg
naccaccttatgttatttcatcatgATGCATATCATCGAAGTCACCAGTTTCAGTTCCAA
GTTTCAGTAGATTTCGGGACATCGTGCGgatcgaagaatacataagagagaaccgtcgcc
aaagaacccattattgttggggtccgttttcaggaagggcaagccatccgacatgtcatc
ctcttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacggaattgt
ggagttatcatgatgagctgccgagtcaatcgatacagtcaactgtctttgacctttgtt
actactctcttccgatgatgatgtcgcacttattctatgctgtctcaatgttagaggcat
atcagtctccactgagctcttttnnnnngggggnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Disc

d1 (->Large)

CLOSE