Strain Information | |
---|---|
DGRC Number | 112146 |
Genotype with FlyBase Link | y[*] w[*] P{w[+mW.hs]=GawB}Moe[NP0343] / FM7c |
Genotype | y* w* P{w+mW.hs=GawB}MoeNP0343 / FM7c |
Break points/Insertion Site | 8B5; -; 8B6 |
Map Viewer | ![]() |
Related Genes | Moe CG1885 |
Original Number | 343 |
Chromosome | 1 |
Comments | FlyBase Insertion: P{GawB}NP0343 NP line. Received from the National Institute of Genetics. |
Balancer | FM7c |
Cluster id | 227 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Embryonic Expression | a small # of cells |
Larval GFP | gut |
Larval X-gal | sg, gut |
Adult GFP | appendages (antenna, proboscis, leg, wing) |
Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np10375_0727 |
Strand | Minus |
Insertion Point | 8629865 |
Chromosome Band | X |
Flanking Sequence | ttaagcgtgcactgaatttaantgtatacttcggtaagcttcggctatcgacgggaccac cttatgttatttcatcatgATATGGACTGTCGTGAAATGCAATCGATGCCAAATTAGTGG TAAAATGGAgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttg gggtccgttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaat ccatgaagagcatccctgggcataaaatccaacggaattgtggagttatcatgatgagct gccgagtcaatcgatacagtcaactgtctttgacctttgttactactctcttccgatgat gatgtcgcacttattctatgctgtctcaatgttagaggcatatcagtctccactgagcca tcttnttntttgggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn |