Strain Information | |
---|---|
DGRC Number | 112334 |
Genotype with FlyBase Link | w[*]; P{w[+mW.hs]=GawB}CG8290[NP0793] / CyO |
Genotype | w*; P{w+mW.hs=GawB}CG8290NP0793 / CyO |
Break points/Insertion Site | 48D5 |
Map Viewer | |
Related Genes | BEST:LD29214 CG8979 |
Original Number | 793 |
Chromosome | 2 |
Comments | FlyBase Insertion: P{GawB}NP0793 NP line. Received from the National Institute of Genetics. |
Balancer | CyO |
Cluster id | 697 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Lethality | semi lethal |
Embryonic Expression | cns |
Larval X-gal | sg |
Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
Lopez-Falcon B, Meyer-Nava S, Hernandez-Rodriguez B, Campos A, Montero D, Rudino E, Vazquez M, Zurita M, Valadez-Graham V. Characterization of the Drosophila group ortholog to the amino-terminus of the alpha-thalassemia and mental retardation X-Linked (ATRX) vertebrate protein. PLoS One (2014) 9(12) e113182 [PubMed ID = 25437195] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np25685_0807 |
Strand | Plus |
Insertion Point | 7035397 |
Chromosome Band | 2R |
Flanking Sequence | tgatnngtntttttgggnngantnnncggggtggaaaacggnacccctaanctngggggc tncggaaaaaccccnggctattngacgggnaccaccttntgttatttcatcatgATTCAG CTGTCTTTCTCGGGTGAAAAAATCTGACACATTTTCGAGGAGACTTGCTGCGAAGCATTC AGTACAGgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggg gtccgttttcaggatnggcaagccatccgacatgtcatcctnttcagaccaatcaaatcc atgaagagcatccctgggcataaaatccaacggaattgtggagttatcatgatgagctgc cgagtcaatcgatacagtcaactgtctttgacctttgttactactctcttccgatgatga tgtcgcacttattctatgctgtctcaatgttagaggcatatcagtctccactgaagccat cttattttggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nn |