Detailed Information [112440]

Strain Information
DGRC Number 112440
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}NP1004 / FM7c
Genotype y* w* P{w+mW.hs=GawB}NP1004 / FM7c
Original Number 1004
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP1004

NP line. Received from the National Institute of Genetics.

Balancer FM7c
General Information NP_lines
Embryonic Expression anterior terminal (SG)
Larval X-gal epi, tr
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Bai L, Sehgal A.
Anaplastic Lymphoma Kinase Acts in the Drosophila Mushroom Body to Negatively Regulate Sleep.
PLoS Genet. (2015) 11(11) e1005611 [PubMed ID = 26536237] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np17035_0807
Flanking Sequence
ATTTTTNGGTGCACTGANTTTATGTGTATACTTCGGTAAGCTTCGGCTATCGACGGGACC
ACCTTATGTTATTTCATCATGATCGAAGAATACATAAGAGAGAACCGTCGCCAAAGAACC
CATTATTGTTGGGGTCCGTTTTCAGGAAGGGCAAGCCATCCGACATGTCATCCTCTTCAG
ACCAATCAAATCCATGAAGAGCATCCCTGGGCATAAAATCCAACGGAATTGTGGAGTTAT
CATGATGAGCTGCCGAGTCAATCGATACAGTCAACTGTCTTTGACCTTTGTTACTACTCT
CTTCCGATGATGATGTCGCACTTATTCTATGCTGTCTCAATGTTAGAGGCATATCAGTCT
CCACTGAAGCCATCTTTTTTTTGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNC
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnn

Library Name / Clone Name np / np58073_0309
Flanking Sequence
attttttactgcgccactatanccgcaagtcatacgttaagtggnatgtctcttgccgac
gggnaccaccttatgttatttcatNCATGCTCCGGNATCCNATNGGCNGGGAGCNTGGNT
NCACTGGCAACATCANTAAAANTAAAACTAGGCANANGATGATCTTACGNCTAATTAATA
AAATAGAGATTAATTTAAAANCCCNCGGCACANGCTAANGGTTAAGNAANAATAAAACCC
CTGGNNANNTNANAGGGGAAANAANANNCANANNNCTGTGTCNTTCANTCGCACTNANNG
NNAGNAAACNTNAANTGGATGNCTCTTGCTGACNGGACCANNATATGTAANGGGATTATG
NTGCGGATCCGNCCCCACTANNTNATATNACCATNNNCTGGNNANNCANNGTNNAGCGCA
GNGNACCCCNNNNANNNNNNNNNANNNAANACTGNANANNNNNNNNNNNNNNNNNAGNNN
AANNAANANNNANNCNNNNNNNNNNNNNANNNNANNNNNAAANNNNANNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE