| Strain Information | |
|---|---|
| DGRC Number | 112459 |
| Genotype with FlyBase Link | y[*] w[*] P{w[+mW.hs]=GawB}NP1029 / FM7c |
| Genotype | y* w* P{w+mW.hs=GawB}NP1029 / FM7c |
| Break points/Insertion Site | --- |
| Map Viewer |  |
| Related Genes | CG2893 CG40302 |
| Original Number | 1029 |
| Chromosome | 1 |
| Comments | FlyBase Insertion: P{GawB}NP1029 NP line. Received from the National Institute of Genetics. |
| Also known as | NP1029-Gal4 1029-Gal4 |
| Balancer | FM7c |
| Cluster id | 2154 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Embryonic Expression | muscle (TU) |
| Larval GFP | pns, heart |
| Larval X-gal | sg |
| Adult GFP | internal |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2025-06-16 |
| Research papers using this strain [Please submit your publication] |
Zabihihesari A, Parand S, Coulthard AB, Molnar A, Hilliker AJ, Rezai P. An in-vivo microfluidic assay reveals cardiac toxicity of heavy metals and the protective effect of metal responsive transcription factor (MTF-1) in Drosophila model. 3 Biotech (2022) 12(10) 279 [PubMed ID = 36275358] [RRC reference] Kuo PH, Tzeng TH, Huang YC, Chen YH, Chang YC, Ho YL, Wu JT, Lee HH, Lai PJ, Liu KY, Cheng YC, Lu SS. Non-invasive Drosophila ECG recording by using eutectic gallium-indium alloy electrode: a feasible tool for future research on the molecular mechanisms involved in cardiac arrhythmia. PLoS One (2014) 9(9) e104543 [PubMed ID = 25226390] [RRC reference] Bradu A, Ma L, Bloor JW, Podoleanu A. Dual optical coherence tomography/fluorescence microscopy for monitoring of Drosophila melanogaster larval heart. J Biophotonics (2009) 2(6-7) 380-8 [PubMed ID = 19504517] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np17155_0807 |
| Strand | Plus |
| Insertion Point | 193399 |
| Chromosome Band | Xh |
| Flanking Sequence | gggggccnagggnnntttttgtttttttttggggantcacacgttttntgaaaanncccc tntnttggggngacttncggaaaagccttcggctatcgacgggnaccactttatgttatt tcatcatgGCCGAGAGAAAAGAGCCGATGCGCGGCATTAGGGAACTCTTTTCAAAGAGCG CGCTGAAGCCGCGCTCAGTTTTCATTGCTCTTAAGTTGCAACTGCACAAAGAAATCATTT TGCTGTTTTgatcgaagaatacataagagagaaccgtcgccaaagaanncattattgttg gggtccgttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaat ccatgaagagcatccctgggcataaaatccaacggaattgtggagttatcatgatgagct gccgagtcaatcgatacagtcaactgtctttgacctttgttactactctcttccgatgat gatgtcgcacttattctatgctgtctcaatgttagaggcatatcagtctccactgagcat nttntttttnggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnn |