Strain Information | |
---|---|
DGRC Number | 112459 |
Genotype with FlyBase Link | y[*] w[*] P{w[+mW.hs]=GawB}NP1029 / FM7c |
Genotype | y* w* P{w+mW.hs=GawB}NP1029 / FM7c |
Break points/Insertion Site | --- |
Map Viewer | |
Related Genes | CG2893 CG40302 |
Original Number | 1029 |
Chromosome | 1 |
Comments | FlyBase Insertion: P{GawB}NP1029 NP line. Received from the National Institute of Genetics. |
Also known as | NP1029-Gal4 1029-Gal4 |
Balancer | FM7c |
Cluster id | 2154 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Embryonic Expression | muscle (TU) |
Larval GFP | pns, heart |
Larval X-gal | sg |
Adult GFP | internal |
Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
Zabihihesari A, Parand S, Coulthard AB, Molnar A, Hilliker AJ, Rezai P. An in-vivo microfluidic assay reveals cardiac toxicity of heavy metals and the protective effect of metal responsive transcription factor (MTF-1) in Drosophila model. 3 Biotech (2022) 12(10) 279 [PubMed ID = 36275358] [RRC reference] Kuo PH, Tzeng TH, Huang YC, Chen YH, Chang YC, Ho YL, Wu JT, Lee HH, Lai PJ, Liu KY, Cheng YC, Lu SS. Non-invasive Drosophila ECG recording by using eutectic gallium-indium alloy electrode: a feasible tool for future research on the molecular mechanisms involved in cardiac arrhythmia. PLoS One (2014) 9(9) e104543 [PubMed ID = 25226390] [RRC reference] Bradu A, Ma L, Bloor JW, Podoleanu A. Dual optical coherence tomography/fluorescence microscopy for monitoring of Drosophila melanogaster larval heart. J Biophotonics (2009) 2(6-7) 380-8 [PubMed ID = 19504517] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np17155_0807 |
Strand | Plus |
Insertion Point | 193399 |
Chromosome Band | Xh |
Flanking Sequence | gggggccnagggnnntttttgtttttttttggggantcacacgttttntgaaaanncccc tntnttggggngacttncggaaaagccttcggctatcgacgggnaccactttatgttatt tcatcatgGCCGAGAGAAAAGAGCCGATGCGCGGCATTAGGGAACTCTTTTCAAAGAGCG CGCTGAAGCCGCGCTCAGTTTTCATTGCTCTTAAGTTGCAACTGCACAAAGAAATCATTT TGCTGTTTTgatcgaagaatacataagagagaaccgtcgccaaagaanncattattgttg gggtccgttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaat ccatgaagagcatccctgggcataaaatccaacggaattgtggagttatcatgatgagct gccgagtcaatcgatacagtcaactgtctttgacctttgttactactctcttccgatgat gatgtcgcacttattctatgctgtctcaatgttagaggcatatcagtctccactgagcat nttntttttnggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnn |