Detailed Information [112459]
 

Strain Information
DGRC Number 112459
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}NP1029 / FM7c
Genotype y* w* P{w+mW.hs=GawB}NP1029 / FM7c
Break points/Insertion Site ---
Map Viewer
Related Genes CG2893 CG40302
Original Number 1029
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP1029

NP line. Received from the National Institute of Genetics.

Also known as NP1029-Gal4 1029-Gal4
Balancer FM7c
Cluster id 2154
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression muscle (TU)
Larval GFP pns, heart
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]

Zabihihesari A, Parand S, Coulthard AB, Molnar A, Hilliker AJ, Rezai P.
An in-vivo microfluidic assay reveals cardiac toxicity of heavy metals and the protective effect of metal responsive transcription factor (MTF-1) in Drosophila model.
3 Biotech (2022) 12(10) 279 [PubMed ID = 36275358] [RRC reference]

Kuo PH, Tzeng TH, Huang YC, Chen YH, Chang YC, Ho YL, Wu JT, Lee HH, Lai PJ, Liu KY, Cheng YC, Lu SS.
Non-invasive Drosophila ECG recording by using eutectic gallium-indium alloy electrode: a feasible tool for future research on the molecular mechanisms involved in cardiac arrhythmia.
PLoS One (2014) 9(9) e104543 [PubMed ID = 25226390] [RRC reference]

Bradu A, Ma L, Bloor JW, Podoleanu A.
Dual optical coherence tomography/fluorescence microscopy for monitoring of Drosophila melanogaster larval heart.
J Biophotonics (2009) 2(6-7) 380-8 [PubMed ID = 19504517] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np17155_0807
Strand Plus
Insertion Point 193399
Chromosome Band Xh
Flanking Sequence
gggggccnagggnnntttttgtttttttttggggantcacacgttttntgaaaanncccc
tntnttggggngacttncggaaaagccttcggctatcgacgggnaccactttatgttatt
tcatcatgGCCGAGAGAAAAGAGCCGATGCGCGGCATTAGGGAACTCTTTTCAAAGAGCG
CGCTGAAGCCGCGCTCAGTTTTCATTGCTCTTAAGTTGCAACTGCACAAAGAAATCATTT
TGCTGTTTTgatcgaagaatacataagagagaaccgtcgccaaagaanncattattgttg
gggtccgttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaat
ccatgaagagcatccctgggcataaaatccaacggaattgtggagttatcatgatgagct
gccgagtcaatcgatacagtcaactgtctttgacctttgttactactctcttccgatgat
gatgtcgcacttattctatgctgtctcaatgttagaggcatatcagtctccactgagcat
nttntttttnggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnn

CLOSE