| Strain Information | |
|---|---|
| DGRC Number | 112589 |
| Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=GawB}NP1248 / CyO, P{w[-]=UAS-lacZ.UW14}UW14 |
| Genotype | y* w*; P{w+mW.hs=GawB}NP1248 / CyO, P{w-=UAS-lacZ.UW14}UW14 |
| Break points/Insertion Site | 35D1; -; 35D2 |
| Map Viewer |  |
| Related Genes | CG15258 nht esg |
| Original Number | 1248 |
| Chromosome | 2 |
| Comments | FlyBase Insertion: P{GawB}NP1248 NP line. Received from the National Institute of Genetics. |
| Balancer | CyUW14 |
| Cluster id | 1199 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Lethality | semi lethal |
| Embryonic Expression | small# of cells (SG) |
| Larval GFP | esg-like |
| Larval X-gal | weak |
| Adult GFP | no specific pattern |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2020-04-03 |
| Research papers using this strain [Please submit your publication] |
Davis JR, Ainslie AP, Williamson JJ, Ferreira A, Torres-Sanchez A, Hoppe A, Mangione F, Smith MB, Martin-Blanco E, Salbreux G, Tapon N. ECM degradation in the Drosophila abdominal epidermis initiates tissue growth that ceases with rapid cell-cycle exit. Curr Biol (2022) 32(6) 1285-1300.e4 [PubMed ID = 35167804] [RRC reference] Kain P, Dahanukar A. Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain. Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Stock Request | |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np03935_0711 |
| Strand | Plus |
| Insertion Point | 15310932 |
| Chromosome Band | 2L |
| Flanking Sequence | tttggtgcactgnctttantgtatacttcggtaagcttcggctatcgacgggaccacctt atgttatttcatcatgGTTCTAGTTGTATATTTACCGTATTGTATTTCTGAGAAATTTTC CTATTTTTTTAAAATTTTTTCTGGGTATTTGGACAAAATCGAATCAAATCCAAGTCGTAA AATTCTCGCCAATTCGATTACCGGAACATGCCCGCAGAAAAAAATTCTATATCATTATCT AATGATGAATTACAGAATAATCATATTAGTACGCCGAAGTAGTAAAGCTATTAATTTATT ATAAATATTCCTAAGgatcgaagaatacataagagagaaccgtcgccaaagaacccatta ttgttggggtccgttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaa tcaaatccatgaagagcatccctgggcataaaatccaacggaattgtggagttatcatga tgagctgccgagtcaatcgatacagtcaactgtctttgacctttgttactactctcttcc gatgatgatgtcgcacttattctatgctgtctcaatgttagaggcatatcagtctccact gagcatctttttttttggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnannnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn |