Detailed Information [112676]
 

Strain Information
DGRC Number 112676
Genotype with FlyBase Link w[*] P{w[+mW.hs]=GawB}NetB[NP1522] / FM7c
Genotype w* P{w+mW.hs=GawB}NetBNP1522 / FM7c
Break points/Insertion Site 12F3
Map Viewer
Related Genes NetB CG15890 CG32595
Original Number 1522
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP1522

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 340
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression mesoderm (SG)
Larval GFP cns
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Okumura T, Fujiwara H, Taniguchi K, Kuroda J, Nakazawa N, Nakamura M, Hatori R, Ishio A, Maeda R, Matsuno K.
Left-right asymmetric morphogenesis of the anterior midgut depends on the activation of a non-muscle myosin II in Drosophila.
Dev. Biol. (2010) 344(2) 693-706 [PubMed ID = 20553709] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np52945_0227
Strand Plus
Insertion Point 14480171
Chromosome Band X
Flanking Sequence
GTGTTCTTCGGNAGCTTCGGCTNTCGACGGGACCCCTTATGTTATTTATCATGCAACAGA
GTGTAACTGAAAAAAAAAATACAACAACGAAGGCCCGACNCGCACTTNGGTTGAATTCGA
TTTCGTNCCGCCTCGAAAACGCCTCGGAATCGCTTCGAAATCGCTCGCTTGCNCCGNTCA
ATGTTGTTCACCTGGCAAACGCTCGGTCGAAACTGTTTGCGTTNGCTTTGCTTTGCTTTT
GGTTTGCCAGAGAGNGGGCAACATTTGATGATGCTGCTTGGCAACATTTTAGCTGCCGCA
ACATTGATGCANACTGAATGTCACANGATGATGCTGGAAGTTCTCGAAAGAAAGTTCATT
TAACTCTTATTCAAAAATATTAAATTACNCGTNTATTCTATTAGCTTATTTTTAATGGGT
AATGCATTTCTAACTTATTCTTAAGCCAAAAATAATTAAAAACTCATTTTCGCTGTTTAA
AAACGGAATACTAAGATAGCACTTCAAAGNGATCGGAGAATTCNTAGGAGAGAACCGTCG
CCAAGAACCCATTTTTGGTGGGGGCCGTTTCANGGANGGCAAGCCATTCCACATGNTATN
CTTTTCAGACCAATCAAATCNTGAGAGCATNCCTGGGCATAAATCCACGGATTGGGGGGT
TTTATGAGAGCTGCCGGTCAATCGATNCAGNCACTGNCTTGACCTTTGTACTACTCTNTT
CCGATGATGATGGCGCACTTATTCTATGCTGTCTCAATGGTAGAGGCATATAGNCCCNCN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

CLOSE