Detailed Information [112830]
 

Strain Information
DGRC Number 112830
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}Akap200[NP2222] / CyO
Genotype w*; P{w+mW.hs=GawB}Akap200NP2222 / CyO
Break points/Insertion Site 29C3
Map Viewer
Related Genes Akap200 CG13398 CG31894
Original Number 2222
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP2222

NP line. Received from the National Institute of Genetics.

Balancer CyO
Cluster id 1114
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression gut
Larval GFP gut
Larval X-gal fg
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Weiss S, Melom JE, Ormerod KG, Zhang YV, Littleton JT.
Glial Ca2+signaling links endocytosis to K+ buffering around neuronal somas to regulate excitability.
Elife (2019) 8 [PubMed ID = 31025939] [RRC reference]

Kis V, Barti B, Lippai M, Sass M.
Specialized Cortex Glial Cells Accumulate Lipid Droplets in Drosophila melanogaster.
PLoS ONE (2015) 10(7) e0131250 [PubMed ID = 26148013] [RRC reference]

Avet-Rochex A, Kaul AK, Gatt AP, McNeill H, Bateman JM.
Concerted control of gliogenesis by InR/TOR and FGF signalling in the Drosophila post-embryonic brain.
Development (2012) 139(15) 2763-72 [PubMed ID = 22745312] [RRC reference]

Stratoulias V, Heino TI.
MANF silencing, immunity induction or autophagy trigger an unusual cell type in metamorphosing Drosophila brain.
Cell. Mol. Life Sci. (2015) 72(10) 1989-2004 [PubMed ID = 25511196] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np22015_0807
Strand Plus
Insertion Point 8412735
Chromosome Band 2L
Flanking Sequence
atnntttggcgtgcactgcaatttatttgtatacttcggtaagcttcggctatcgacggg
accaccttatgttatttcatcatgCACTGAGCCATGAAAAAGAAGAAGGAGAAGCAGAAG
AAGGTGACTCTGCGTGGGCAGGCGACAAATTTATTGGCACTTATTCGCTTATTCCCGCTT
TTCCGCCCTTTCTTGTCTATAAAGAAAAAAGGAAGCCCCCAAGCTTTGAATATTCAAATA
TTTATTGTAATTATTTTCAACACCGGCCCACAGCGTAGTTGATTTAAGTGCGCGCTCATT
TGATACCCTGTAATGGGTGAGTGTGGGGGGTATATTATGGTGCCGGTACGATGTGGTAGA
CTGAGAAAAAATTGCATGAAATCAGGAAgatcgaagaatacataagagagaaccgtcgcc
aaagaacccattattgttggggtccgttttcaggaagggcaagccatccgacatgtcatc
ctcttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacggaattgt
ggagttatcatgatgagctgccgagtcaatcgatacagtcaactgtctttgaccctttgg
tactactctcttccgatgatgatgtcgcacttattctatgctgtctcaatgttagaggca
tatcagtctcctncatnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

CLOSE