Detailed Information [112830]
 

Strain Information
DGRC Number 112830
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}Akap200[NP2222] / CyO
Genotype w*; P{w+mW.hs=GawB}Akap200NP2222 / CyO
Break points/Insertion Site 29C3
Map Viewer
Related Genes Akap200 CG13398 CG31894
Original Number 2222
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP2222

NP line. Received from the National Institute of Genetics.

Also known as CG-Gal4
Balancer CyO
Cluster id 1114
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression gut
Larval GFP gut
Larval X-gal fg
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2022-05-16
Research papers using this strain
[Please submit your publication]
Fioriti F, Rifflet A, Gomperts Boneca I, Zugasti O, Royet J.
Bacterial peptidoglycan serves as a critical modulator of the gut-immune-brain axis in Drosophila.
Brain Behav Immun (2024) 119 878-897 [PubMed ID = 38710338] [RRC reference]

Miao H, Wei Y, Lee SG, Wu Z, Kaur J, Kim WJ.
Glia-specific expression of neuropeptide receptor Lgr4 regulates development and adult physiology in Drosophila.
J Neurosci Res (2024) 102(1) e25271 [PubMed ID = 38284837] [RRC reference]

Coll-Tane M, Gong NN, Belfer SJ, van Renssen LV, Kurtz-Nelson EC, Szuperak M, Eidhof I, van Reijmersdal B, Terwindt I, Durkin J, Verheij MMM, Kim CN, Hudac CM, Nowakowski TJ, Bernier RA, Pillen S, Earl RK, Eichler EE, Kleefstra T, Kayser MS, Schenck A.
The CHD8/CHD7/Kismet family links blood-brain barrier glia and serotonin to ASD-associated sleep defects.
Sci Adv (2021) 7(23) [PubMed ID = 34088660] [RRC reference]

Lin YE, Lin CH, Ho EP, Ke YC, Petridi S, Elliott CJ, Sheen LY, Chien CT.
Glial Nrf2 signaling mediates the neuroprotection exerted by Gastrodia elata Blume in Lrrk2-G2019S Parkinson's disease.
Elife (2021) 10 [PubMed ID = 34779396] [RRC reference]

de Torres-Jurado A, Manzanero-Ortiz S, Carmena A.
Glial-secreted Netrins regulate Robo1/Rac1-Cdc42 signaling threshold levels during Drosophila asymmetric neural stem/progenitor cell division.
Curr Biol (2022) 32(10) 2174-2188.e3 [PubMed ID = 35472309] [RRC reference]

Kowada R, Kodani A, Ida H, Yamaguchi M, Lee IS, Okada Y, Yoshida H.
The function of Scox in glial cells is essential for locomotive ability in Drosophila.
Sci Rep (2021) 11(1) 21207 [PubMed ID = 34707123] [RRC reference]

Juarez-Carreno S, Vallejo DM, Carranza-Valencia J, Palomino-Schatzlein M, Ramon-Canellas P, Santoro R, de Hartog E, Ferres-Marco D, Romero A, Peterson HP, Ballesta-Illan E, Pineda-Lucena A, Dominguez M, Morante J.
Body-fat sensor triggers ribosome maturation in the steroidogenic gland to initiate sexual maturation in Drosophila.
Cell Rep (2021) 37(2) 109830 [PubMed ID = 34644570] [RRC reference]

Park YJ, Kim S, Shim HP, Park JH, Lee G, Kim TY, Jo MC, Kwon AY, Lee M, Lee S, Yeo J, Chung HL, Bellen HJ, Kwon SH, Jeon SH.
Phosphatidylserine synthase plays an essential role in glia and affects development, as well as the maintenance of neuronal function.
iScience (2021) 24(8) 102899 [PubMed ID = 34401677] [RRC reference]

Dong Q, Zavortink M, Froldi F, Golenkina S, Lam T, Cheng LY.
Glial Hedgehog signalling and lipid metabolism regulate neural stem cell proliferation in Drosophila.
EMBO Rep (2021) 22(5) e52130 [PubMed ID = 33751817] [RRC reference]

Nandakumar S, Grushko O, Buttitta LA.
Polyploidy in the adult Drosophila brain.
Elife (2020) 9 [PubMed ID = 32840209] [RRC reference]

Kim T, Shin H, Song B, Won C, Yoshida H, Yamaguchi M, Cho KS, Lee IS.
Overexpression of H3K36 methyltransferase NSD in glial cells affects brain development in Drosophila.
Glia (2020) 68(12) 2503-2516 [PubMed ID = 32531091] [RRC reference]

Weiss S, Melom JE, Ormerod KG, Zhang YV, Littleton JT.
Glial Ca2+signaling links endocytosis to K+ buffering around neuronal somas to regulate excitability.
Elife (2019) 8 [PubMed ID = 31025939] [RRC reference]

Kis V, Barti B, Lippai M, Sass M.
Specialized Cortex Glial Cells Accumulate Lipid Droplets in Drosophila melanogaster.
PLoS One (2015) 10(7) e0131250 [PubMed ID = 26148013] [RRC reference]

Stratoulias V, Heino TI.
MANF silencing, immunity induction or autophagy trigger an unusual cell type in metamorphosing Drosophila brain.
Cell Mol Life Sci (2015) 72(10) 1989-2004 [PubMed ID = 25511196] [RRC reference]

Avet-Rochex A, Kaul AK, Gatt AP, McNeill H, Bateman JM.
Concerted control of gliogenesis by InR/TOR and FGF signalling in the Drosophila post-embryonic brain.
Development (2012) 139(15) 2763-72 [PubMed ID = 22745312] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np22015_0807
Strand Plus
Insertion Point 8412735
Chromosome Band 2L
Flanking Sequence
atnntttggcgtgcactgcaatttatttgtatacttcggtaagcttcggctatcgacggg
accaccttatgttatttcatcatgCACTGAGCCATGAAAAAGAAGAAGGAGAAGCAGAAG
AAGGTGACTCTGCGTGGGCAGGCGACAAATTTATTGGCACTTATTCGCTTATTCCCGCTT
TTCCGCCCTTTCTTGTCTATAAAGAAAAAAGGAAGCCCCCAAGCTTTGAATATTCAAATA
TTTATTGTAATTATTTTCAACACCGGCCCACAGCGTAGTTGATTTAAGTGCGCGCTCATT
TGATACCCTGTAATGGGTGAGTGTGGGGGGTATATTATGGTGCCGGTACGATGTGGTAGA
CTGAGAAAAAATTGCATGAAATCAGGAAgatcgaagaatacataagagagaaccgtcgcc
aaagaacccattattgttggggtccgttttcaggaagggcaagccatccgacatgtcatc
ctcttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacggaattgt
ggagttatcatgatgagctgccgagtcaatcgatacagtcaactgtctttgaccctttgg
tactactctcttccgatgatgatgtcgcacttattctatgctgtctcaatgttagaggca
tatcagtctcctncatnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

CLOSE