Detailed Information [112912]
 

Strain Information
DGRC Number 112912
Genotype with FlyBase Link w[*] P{w[+mW.hs]=GawB}amn[NP2397] / FM7c
Genotype w* P{w+mW.hs=GawB}amnNP2397 / FM7c
Break points/Insertion Site 18F4; -; 19A2
Map Viewer
Related Genes amn CG15618 CG32529
Original Number 2397
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP2397

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 472
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression a small # of cells
Larval GFP epi
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Shuai Y, Hirokawa A, Ai Y, Zhang M, Li W, Zhong Y.
Dissecting neural pathways for forgetting in Drosophila olfactory aversive memory.
Proc. Natl. Acad. Sci. U.S.A. (2015) 112(48) E6663-72 [PubMed ID = 26627257] [RRC reference]

Lin TY, Luo J, Shinomiya K, Ting CY, Lu Z, Meinertzhagen IA, Lee CH.
Mapping chromatic pathways in the Drosophila visual system.
J. Comp. Neurol. (2016) 524(2) 213-27 [PubMed ID = 26179639] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np21475_0807
Flanking Sequence
GNGNGNNNNNTGGGNGGGNNNGNNGNGTTTTTGGGNNGATTAATGNNGGAANAGNCCTTN
TTGGGGGNNGGAAAACCCGGNNTTGNCGGGNCCCCTTTTTTGGGNNTNNTGGNCCAANNN
GTGNNCGNGCNGNNGNNNANCGCTGGNCCGNGGTNCTNTGGGGCNTNNGGNCTGTNNTTT
NTNCNNNNNNNNNNNCCTGNTNNNCTNTNGGNGATNTTNGGNNGANTNGGGNGGNNGGCG
NNTNNCATNTTTTTTTTTTTNNNNNGGNNNNGTGGGGGGGGGNNANCNNCGNCCNNTTTT
TNNNNNNGNNNNNNNGNNNNNNNGGGGGGGGNNTTTTNNNNGNNNNNNNGNNNNNGNNNN
NNNNNNGNNNNNNNNNNNNNNNNGGGGNNNGGGNNNNNNNGNGGNGGGNGNGGGGNNNNN
GGGGGGGNNNGGGGNGGGGGGGGNNNGGGNNNNGGNNNNNNNGNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNN
NGNGGNNNGNGNGNGGGNGGGGGGGGGGGGGGNGNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngnnnnnn
nnn

Library Name / Clone Name np / np59433_0309
Strand Minus
Insertion Point 19618143
Chromosome Band X
Flanking Sequence
GAAGCNTCGTTAGTGGATGTCTCTTGCCGACGGGACCCCTTATGTTATTTATCATGGTTT
GGGCCACACTTGTCGCCTCTTGGCCATTATGCAACGACAGCGAAACGAAGGTGCTCACGA
AGTGGCCAAGCTGCTCTCTGATTGGTCGGCGGTCAGTGCCACGAGGCCAGCCGAAGTTCT
CTCGCGAGAACCCAAGAGCACTCTCTCCCTCTCTTTTGGGAGAGATGAGATAGCAAAGAA
AAGCCAAAACACTAGAACAATCCAGAAGCCAAGTTTTCCGGCTTGCACATACGCCGTATA
ATCCGCATTTTTTGCGAACTCTAAACTCGAGTCTATCAGCTATAATATTACAATTCGGTC
ACTATAAACAAATNAACTAATATAGGTTTGCTCANAAATCGATGCNCTTTGATGAGGAGA
ATAGNGGAAAACAAATTCTCAGGTNANAGCTTTTTAAACTGNGCTGCAAATGGGNAAACA
AATTTAAAANTTCCCCNTTTTCATNCCCNAANAAAAAGGAANACCCTAACCCTTCCCTTN
TTTAGGCCNAAAACAATAAAAAATTTNTTANGCNCNCNTTTGACCCNNNNNCCCGNNGCC
TTGGGGNCNTNNNGGNNTNNNNNTTCNTTTNANNNTNNGNTTTTNNNNNNNNNNNNNNNN
NNNNTTNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNTNNNNNNNNTNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnntnnnnnnnnannnnnnnnnnnnnnnnnnnnnnnnnnnnnnntnnnnnnnnnnnnnnn
nnnntntnnnnnnnntnnnttnnnnnnnnnttnnnnnncncntttnnnnnnnnnnnnnct

Image Files
Disc

d1 (->Large)

CLOSE