Detailed Information [112976]
 

Strain Information
DGRC Number 112976
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}Tsp[NP2583] / CyO
Genotype w*; P{w+mW.hs=GawB}TspNP2583 / CyO
Break points/Insertion Site 27A1
Map Viewer
Related Genes GRHR Tsp
Original Number 2583
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP2583

NP line. Received from the National Institute of Genetics.

Balancer CyO
Cluster id 1076
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression lateral epi stripe
Larval GFP weak
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Shuai Y, Hirokawa A, Ai Y, Zhang M, Li W, Zhong Y.
Dissecting neural pathways for forgetting in Drosophila olfactory aversive memory.
Proc. Natl. Acad. Sci. U.S.A. (2015) 112(48) E6663-72 [PubMed ID = 26627257] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np23205_0807
Strand Minus
Insertion Point 6701024
Chromosome Band 2L
Flanking Sequence
GGGGGGGNAAGGNNTNGTTTTNNTTTTTTGGTTNNAANTCNACACGCGTGTNAANAAGNC
CCAATTANTCTTGGGACTNNCGGAAAAGACTTCGGCTATTCGACGGGNACCACCTTTATN
TTATTTCATCATGTGTGTCCCCATTCCAAAATCCAGCTTTTCTACCTGGCGCGNACATAT
TTCGAAAAGGGTTTAAATGGTCTAATGCATCCGTTTCGTTATCGATTCTTTTAGTGTGAA
GATACCCTTGCGACTTGTTTGATCGAAGAATACATANGAGAGAACCGTCGCCAAAGANCC
NNNGATTGTTGGGGTCCGTTTTCAGGAAGGGCAAGCCATCCGACATGTCATCCTCTTCAG
ACCAATCAAATCCATGAAGAGCATCCCTGGGCATAAAATCCAACGGAATTGTGGAGTTAT
CATGATGAGCTGCCGAGTCAATCGATACAGTCAACTGTCTTTGACCTTTGTTACTACTCT
CTTCCGATGATGATGTCGCACTTATTCTATGCTGTCTCAATGTTAGAGGCATATCAGTCT
CCACTGAAGCCATCTTNNTTTTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnn

CLOSE