Strain Information | |
---|---|
DGRC Number | 113080 |
Genotype with FlyBase Link | w[*]; P{w[+mW.hs]=GawB}CG2162[NP3056] |
Genotype | w*; P{w+mW.hs=GawB}CG2162NP3056 |
Break points/Insertion Site | 63A3 |
Map Viewer | ![]() |
Related Genes | aly CG2162 S-element{}915 |
Original Number | 3056 |
Chromosome | 3 |
Comments | FlyBase Insertion: P{GawB}NP3056 NP line. Received from the National Institute of Genetics. |
Cluster id | 1758 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Embryonic Expression | weak |
Larval GFP | fb, sg |
Larval X-gal | sg, mt |
Adult GFP | internal |
Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
Rozenfeld E, Lerner H, Parnas M. Muscarinic Modulation of Antennal Lobe GABAergic Local Neurons Shapes Odor Coding and Behavior. Cell Rep (2019) 29(10) 3253-3265.e4 [PubMed ID = 31801087] [RRC reference] Mohamed AAM, Retzke T, Das Chakraborty S, Fabian B, Hansson BS, Knaden M, Sachse S. Odor mixtures of opposing valence unveil inter-glomerular crosstalk in the Drosophila antennal lobe. Nat Commun (2019) 10(1) 1201 [PubMed ID = 30867415] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np34555_0907 |
Strand | Plus |
Insertion Point | 3019025 |
Chromosome Band | 3L |
Flanking Sequence | acgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccacctta tgttatttcatcatgGTCCAAGTCGAAGAAAAGCAAATCGCATCGGGAGCGCAGAGAACG CGCAAAGAAAACGACAACAGCTACAACGGCCGATAACGCCACTGTACTGGTTATATCAGC ATCTGAGAACGATACTCAATCCAACGAAGAACACCGACCGGCAAAGCCAGCGGACTGTGA TAAGGAGGTGTGTGTACTAAAACAAGACAAGAACGTATATAAGCGAATCTAAAGCCTATG AATTAGTTCTTATTAACAATAATTGTTCAGCGTAGCGCCATTCTCCATCAGCAGTTAGAA TTTTTTAATACACATTTTAATAGCTGACCTTGCCTTTCTAACATACAgatcgaagaatac ataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggca ngccatccgacatgtcatcctnttcagaccaatcaaatccatgaagagcatccctgggca taaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatacagtca actgnctttgacctttgttactactctcttccgatgatgatgtcgcacttattctatgct gnctcaatgttagaggcatatcagtctccactgagcnnnnnntttttnnggggnnnnnnn nnnnnnnnnnnnngnnnnnnnnngggccntnncncnnntnncnnnnnnnnnnnnnnnnnn nnnnnnnnnnannccnccnnnnggnannncncnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnngnnnnnnnngnncnnnnnnnnnnnnnnnannnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn |