Detailed Information [113080]
 

Strain Information
DGRC Number 113080
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}CG2162[NP3056]
Genotype w*; P{w+mW.hs=GawB}CG2162NP3056
Break points/Insertion Site 63A3
Map Viewer
Related Genes aly CG2162 S-element{}915
Original Number 3056
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP3056

NP line. Received from the National Institute of Genetics.

Cluster id 1758
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression weak
Larval GFP fb, sg
Larval X-gal sg, mt
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Mohamed AAM, Retzke T, Das Chakraborty S, Fabian B, Hansson BS, Knaden M, Sachse S.
Odor mixtures of opposing valence unveil inter-glomerular crosstalk in the Drosophila antennal lobe.
Nat Commun (2019) 10(1) 1201 [PubMed ID = 30867415] [RRC reference]

Rozenfeld E, Lerner H, Parnas M.
Muscarinic Modulation of Antennal Lobe GABAergic Local Neurons Shapes Odor Coding and Behavior.
Cell Rep (2019) 29(10) 3253-3265.e4 [PubMed ID = 31801087] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np34555_0907
Strand Plus
Insertion Point 3019025
Chromosome Band 3L
Flanking Sequence
acgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccacctta
tgttatttcatcatgGTCCAAGTCGAAGAAAAGCAAATCGCATCGGGAGCGCAGAGAACG
CGCAAAGAAAACGACAACAGCTACAACGGCCGATAACGCCACTGTACTGGTTATATCAGC
ATCTGAGAACGATACTCAATCCAACGAAGAACACCGACCGGCAAAGCCAGCGGACTGTGA
TAAGGAGGTGTGTGTACTAAAACAAGACAAGAACGTATATAAGCGAATCTAAAGCCTATG
AATTAGTTCTTATTAACAATAATTGTTCAGCGTAGCGCCATTCTCCATCAGCAGTTAGAA
TTTTTTAATACACATTTTAATAGCTGACCTTGCCTTTCTAACATACAgatcgaagaatac
ataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggca
ngccatccgacatgtcatcctnttcagaccaatcaaatccatgaagagcatccctgggca
taaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatacagtca
actgnctttgacctttgttactactctcttccgatgatgatgtcgcacttattctatgct
gnctcaatgttagaggcatatcagtctccactgagcnnnnnntttttnnggggnnnnnnn
nnnnnnnnnnnnngnnnnnnnnngggccntnncncnnntnncnnnnnnnnnnnnnnnnnn
nnnnnnnnnnannccnccnnnnggnannncncnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnngnnnnnnnngnncnnnnnnnnnnnnnnnannnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

CLOSE