Detailed Information [113094]

Strain Information
DGRC Number 113094
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP3084
Genotype y* w*; P{w+mW.hs=GawB}NP3084
Break points/Insertion Site 31F4
Map Viewer
Related Genes CG13144 CG6094 Myo31DF
Original Number 3084
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP3084

NP line. Received from the National Institute of Genetics.

Cluster id 1151
General Information NP_lines
Embryonic Expression hg
Larval GFP sg, gut
Larval X-gal all gut
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Yin S, Qin Q, Zhou B.
Functional studies of Drosophila zinc transporters reveal the mechanism for zinc excretion in Malpighian tubules.
BMC Biol. (2017) 15(1) 12 [PubMed ID = 28196538] [RRC reference]

Tastekin I, Riedl J, Schilling-Kurz V, Gomez-Marin A, Truman JW, Louis M.
Role of the subesophageal zone in sensorimotor control of orientation in Drosophila larva.
Curr. Biol. (2015) 25(11) 1448-60 [PubMed ID = 25959970] [RRC reference]

Riedl, Julia
Identification of neurons controlling orientation behavior in the Drosophila melanogaster larva
Doctoral Thesis, Universitat Pompeu Fabra (2014) [RRC reference]

Xiao G, Wan Z, Fan Q, Tang X, Zhou B.
The metal transporter ZIP13 supplies iron into the secretory pathway in Drosophila melanogaster.
Elife (2014) 3 e03191 [PubMed ID = 25006035] [RRC reference]

Bonnay F, Cohen-Berros E, Hoffmann M, Kim SY, Boulianne GL, Hoffmann JA, Matt N, Reichhart JM.
big bang gene modulates gut immune tolerance in Drosophila.
Proc. Natl. Acad. Sci. U.S.A. (2013) 110(8) 2957-62 [PubMed ID = 23378635] [RRC reference]

Qin Q, Wang X, Zhou B.
Functional studies of Drosophila zinc transporters reveal the mechanism for dietary zinc absorption and regulation.
BMC Biol. (2013) 11 101 [PubMed ID = 24063361] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np34775_0907
Strand Minus
Insertion Point 10499195
Chromosome Band 2L
Flanking Sequence
gtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccaccttatg
ttatttcatcatgGTCTGACCACAGTCCCTCTGCAACTTTCATTGAATGCGGTCGAGTGC
GGTTGTGCGACGGCCGATTGTTGTTATTAATCCGCCGCAAACGAAACTGAATCCAGGTGG
GCACTCACACCgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgn
tggggtccgtnttcaggaaggncaagccatccgacatgtnatcctcttcagaccaatcaa
atccatgaagagcatccctgggcataaaatccaacgggatttgtgggagttatcatgatg
agctgccgagtcaatcgatacagtcaactgtctttgacctttggtactactctctttccg
atgatgatgtcgcacttatttctatgctgtctcaatgttagaggcatatcagtctccact
gaagcatnttttttttgggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnannnn
nnnnntnnncnnnnngnnnnnannnnnnnnnnnnnnnnnnnannnnnnnccttnnnnnnn
tnnnnnnnnnnnnnnnnnnnnngnnnnnnnnnnnnnnnnnnngnnnncnatnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE