Detailed Information [113157]
 

Strain Information
DGRC Number 113157
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}NP3207 / FM7c
Genotype y* w* P{w+mW.hs=GawB}NP3207 / FM7c
Original Number 3207
Chromosome 1
Comments NP line. Received from the National Institute of Genetics.
Balancer FM7c
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression all muscle, cns midline
Larval GFP sg, fb
Larval X-gal fb, gut
Adult GFP body wall
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Nakagawa Y, Fujiwara-Fukuta S, Yorimitsu T, Tanaka S, Minami R, Shimooka L, Nakagoshi H.
Spatial and temporal requirement of defective proventriculus activity during Drosophila midgut development.
Mech. Dev. (2011) 128(5-6) 258-67 [PubMed ID = 21376808] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np35765_0907
Flanking Sequence
GNGGGGCCAGGGNGGTGNTTNGTTTTTNTTGGGNGGANTNACACGNGGTGTCANANAACN
CGNNNNTTGGGGCGNNCGGTAAGACTCCCGGCTATCGACGGGNACCACCTTNTGTTATTT
CATCATGGATCGAAGAATACATAAGAGAGAACCGTCGCCAAAGTAACGGAGTATTGTTGG
GGTCCGATTTCAGGAAGGGCAAGCCATCCGACATGTCATCCTCTTNAGACCAATCAAATC
CATGAAGAGCATNCCTGGGCATANANTNCAACGGAANTGTGGAGTTATCANGGGGNGCTG
CCGAGTCAATCGATACAGACAACTGTCTTTGACCTTTGNTACTACTCTCTTCCGATGATG
ATGNCGCACTNATTCTATGCTGNCTCAATGTNAGAGGCATATCAGTCTNCACTGAAGCCA
TCTTNNTCTGCAATNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np63533_0309
Flanking Sequence
GNGNNNGNGNGNGGNGGGGCCGCCGGGGGCGGGCGCGCCNGGTTTTCGGGNCNANCCANN
GGGGCAAANCCNCNGTTTGGGGGAGNGGNAGACCCTTGCCGACGGGNACCACCTNAGTTA
TTTCATCATGAGCTGANCCGNGGGCGGNCGCANAGGCCACNAGNGGANCGGGNGNCNCNA
GCNAGAGCNGNGNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGG
GGGGGGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNGNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnngnnnnnnnnnnnnnnnnngnnnnnnnnnnnn
ngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnngngnnnnnnncngnnnnnnnnnnnnncncncgcn

CLOSE