Detailed Information [113160]
 

Strain Information
DGRC Number 113160
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP3212
Genotype w*; P{w+mW.hs=GawB}NP3212
Break points/Insertion Site ---
Map Viewer
Related Genes CG40112 CG40116
Original Number 3212
Chromosome 3
Comments NP line. Received from the National Institute of Genetics.
Cluster id 2116
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression weak epi stripe (SG), a small # of cells @(TU)
Larval GFP epi
Larval X-gal sg, tr
Adult GFP tarsas, female genitalia
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Shuai Y, Hirokawa A, Ai Y, Zhang M, Li W, Zhong Y.
Dissecting neural pathways for forgetting in Drosophila olfactory aversive memory.
Proc. Natl. Acad. Sci. U.S.A. (2015) 112(48) E6663-72 [PubMed ID = 26627257] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np35815_0907
Flanking Sequence
annttnggtgcactgantttanttgtatacttcggtaagcttcggctatcgacgggacca
ccttatgttatttcatcatgGTGTGAAGGGTTTCTGGATCGNNCAATACATNGAGANAGA
ACCGTNNCCNAAGCAACCCATCNTNGNTGGGGTCCGGTNTCANGAAGGGCAAGCCGTCCG
ACACGTNATCCTCTTCAAACCAATCAAATCCAGGAANTANCATCCCTGGGCATAAAATCC
ANCGGAAGTTGTGNAGATATCATNAGCNAGCTNCCGAGACAANCGANACAGTCAACTGGC
TTTGACCTTTGTTACTACTCTCTTTCCNAAGATGATGTCGNACTTATTCTATGCTGTCTC
AATGGTNGAGGCATATCANCCTCCACTGAAGCCATCTTATTTTGGGNTTCNNATTTCNCT
TCCNCTTTTTNTGGGTNANCCGANNTGGAATTAAAATCCAAGNNGAANAGTTTTCCCCAA
TTTNTTTGGGGNNAAGNTTCTGNTGNTTGNTNAAAAGGGNCCCCAAGGGNGGAACACCGC
CAACCATTTTGGGAANATCCGNNNNTNCNTNANAAGAAACCNNNNNCNAAAAACCCNTTN
TNGGGGGGGNCCNNNNNNANGAAGGGNNANCCCTCCCNNNNNNNNNCNTTTTTNNNCCNN
NNNAANCCNNNNNNGGNNNCCCNGGGNNNAAAANNCNANGGNNNGGGGGNNTNTNCNNNN
NNNNNNNCCNNNNNAANNNNNNCNNNNNANNGNNNTTNNCCNTNNNNNCANNNNTTTNNC
CNNNNNGNNGNNNCNCNTTNttntntncnnnnnnaangnnnnngggnttnnnnnnccccc
ntgnnccnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np63553_0309
Strand Minus
Insertion Point 4686547
Chromosome Band U
Flanking Sequence
tttactcgcacttattgaagcatacgttaagtggatgtctcttgccgacgggaccncctt
atgttatttcatcatgCTTCACACCTTTATCAGCAGAGTGGATTACGTAATTTCGCTCTA
CCAAACAAATGATGTCCGACAACAGAGGATTCTACTGGGAGCCATCGAAAGGAACTTGGA
CGGACAAATTACACGATCCTCNGCCNGCCGCNTAGGCCACTAGTGGATNTGGATCCTCTA
GCTAGAGCTTTGNTTACTCNNAANTNATTAAAAATAATAACTTTNAAAATAATNGGCGNC
TGATNAANATTATNANTNAATAANAACCCCGCCNNCTTNCTANNNGNGGATAAACAACCA
TAATNNNNANTTCNTANNCNACCNCTGGAAGGNAACCAAACTNNTNTTNTTATTNNTANT
CNTNGNNGCNANGATTCTTTTANNATTNTTTNNCGGANNNNNCCACCNNATGNTNTNNTA
TNNTANTNCNTNCNNNNNTANNANNNTNNNNNNCNNNNNNNTNNTNNTNNNNNNANNNNN
NNGNNNNNNNNNNNNNNNNNNNTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT
NNTNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnntnnnt

CLOSE