Detailed Information [113382]
Strain Information
DGRC Number 113382
Genotype with FlyBase Link w[*] P{w[+mW.hs]=GawB}hiw[NP4013] / FM7c
Genotype w* P{w+mW.hs=GawB}hiwNP4013 / FM7c
Break points/Insertion Site 13A5
Map Viewer
Related Genes eag hiw CG32594 rover{}133
Original Number 4013
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP4013
NP line. Received from the National Institute of Genetics.
Balancer FM7c
Cluster id 347
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression gut (TU) epi stripe (?) and yalk cells (SH)
Larval GFP ubiquitous. strong gut
Larval X-gal hinge in wing disc
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Zhao H, Zheng X, Yuan X, Wang L, Wang X, Zhong Y, Xie Z, Tully T.
ben Functions with scamp during synaptic transmission and long-term memory formation in Drosophila.
J. Neurosci. (2009) 29(2) 414-24 [PubMed ID = 19144841] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request
---

Library & Clone Information
Library Name / Clone Name np / np11255_0727
Flanking Sequence
gggggnnnngnntgtttngttttttgggnnngantaaacgtnggtganannacccctttt
ttttgtacttncggtaagacttcggctatcgacgggnaccaccttatgttatttcatcat
gGTTTAGCTCTAAAGCTACCGTCTCGTCgatcgaagaatacataagagagaaccgtcgcc
aaagaacccattattgttggggtccgttttcaggaagggcaagccatccgacatgtcatc
ctcttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacggaattgt
ggagttatcatgatgagctgccgagtcaatcgatacagtcaactgtctttgacctttgtt
actactctcttccgatgatgatgtcgcacttattctatgctgtctcaatgttagaggcat
atcagtctccactgaagccatcttattctggnncnannnnnnntnnnnnnnnnnngnnnn
nnnnannnnnngnngnnnnanngnnnnnggnnnnnnnnnnnnnnnntgnnnncnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np28645_0807
Flanking Sequence
antctttngggtgcaanagccctttatttgtatacttcggtaagcntcggctatcgacgg
gaccaccttatgttatttcatcatgGTTTAGCTCTAAAGCTACCGTCTCGTCgatcgaag
aatacataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaa
gggcaagccatccgacatgtcatcctcttcagaccaatcaantnnttgaagagcatccct
gggcataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatac
agtcaactgtctttgacctttgttactactctcttccgatgatgatgtcgcacttattct
atgctgtctcaatgttagaggcatatcagtctccactgagcatcttntttnttggggnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnann

Library Name / Clone Name np / np56323_0309
Flanking Sequence
atatttnggggaaaaaaccccaagttttggggaaggggaagaacccttgccgacgggcac
caccttatgttatttNATNATGNACCATNCGATCNGATAGNCGGNGNAGANGCGAANAAA
TCGAACNATTNAGTCAGAAAACNTANAANGTGAGCACGGNGACGGGGTGATACTGGACCC
ANTATNATNCNGGNGCTAGAGNTTGGCAGANANGGGAAANAGGNTAGAAATGGGGTTTTT
TTTTTTANTAANAAGNCANGNNANNTCGTNAGGGNAGGAGGCGTNNAANTTNTGTNAACG
NNNCACNATNTNNNCGNAACCNGGTNTAGGNTCCAANAATAANGTNTNAGAGAGCNNGGA
GCNGTNTNTNGTTNNNGANCGNATNNTCNACCTTATAANNNTNCANNNNANNTGTANNAN
GAANCNNNNGANAGATNGNNAANTCTTNANNNNNNNNTATTNTTANTATGGAANNNGNNG
TCTNCANNNNNGNACNNTNTNNNTNNGNTAACANNNAGGNTNCNNNNGNAGGNNAAGNGN
CAANTCAACANNATTTNACNTNANTACACNGNNNCNNNAGAGNNNAAGNTNNNNTNNAAG
ANNNGANAGNNANNNTNNGAGNNGNTTNNANNNANNTNAGANTAGNTNNGNTNGNNNTAC
NTTGNCTNTCNNCGGNCTNGGTAGAAANANNTGTNCCNCCACNANNTNTAGNTGCGNTNA
NNTTTCNAANNTNANAANATANCTGNGAATGTTNNNNTTNCANAAGANNGAGAATTTAAA
TNANGNGNNACNGNATNNAGaacgagatgnnagngnncangannctgnangnagnganan
ggggngaantnggtgannngnnntnagnagcgcccaannaggtatncgngngcnanggtn
ggntnngatngatgagtgcnnnttgcannagaatangaatgannncacagnnntcncaga
ngnacangagnccngnnnnnagtntanatnatatgagncgtgactanngtnaaaaatnac
nacgggaannngtgagagagnncgttnnttgantntaatgtggngnnctntnngannnta
tanntgnanataantncacntangnntnntnggtggnggtntntnngngttgtattatat
agaaaananatntatnananngtnacanncnnnnngctgntagaaganngaaggnagaga
nnanatnancggcggagatagaatcgantngtatanagtccantnntgnagtcntatacn
ntgngnantnacgnancnntnttcnntngnnnnncatnntatggaanntancacggnatn
tcantngntntnaacgcgtngtntnataangaaatgnatntgaanannngtnttacngng
naannnnat

Library Name / Clone Name np / np61643_0309
Strand Plus
Insertion Point 14755454
Chromosome Band X
Flanking Sequence
ttattgaagcatacgttaagtggatgtctcttgccgacgggaccccttatgttatttcat
catgAGCTAAACGAACTGCCATCCGGTAAACACGTCTCACAACGTTATTTGTGTTGAATA
TATATATATTTTTTTGTTGTGGCTCTTTTTTTTTAATTTCTGCGGCCCCTAAAGTTCGAC
GATCCTCTAGCTAGAGCTTTGNNNACTNGCGAATTATGAAAACTANAACTTGAGNANTNA
TTNCGCCNAATTAATATTATGAGTAAATTCAAACCCCACGGCCATGCTAAGGGTTAATNA
ACAATCATATCGNTGNNGAACTNNAAAACNATTCNCNCCTNCANTNCCCNNGNCNTNNTA
NCGTNNCTTAANGGCNNCCGNTCNNTGGNNNGTNNCCCTNANNTCNNTCCTTTCNCCCNN
NTNTNNCATTTACGGTGTNTTNTTNANNANNNNTNNNNNATTNNGNCCNNANCNCGCCNC
CCANCNTTTTTCCNNNNNGCNCNACNCCCNCTTTTTNNCNNNNGNNCNNNAATNNNNGTT
ANACNGNCTGTGTTCCCCCACGANNNGCGCCCCCCNTCGNGCNTTTAGNNCNCGNTCACN
CCCCNNTTCNCNTNANCNNANCCCCCNCCNCNNANTNCCCGCCTCCNGNCGCACNNCGNN
NCGCNNANCNCCCNCCANNCNNNGCTNGCGTNANNTNNCGGCNACNCATCCATTAGCATC
GANNTCCATTCCTTTNTTTNTCNTNNCCNCNTATCTGTNCCCNCTGTCNNACCCCNCCGC
NCTTNNTNNTNTTCANCNCCnncgntnnttttntnncggtccccancnncccnnancctg
tcntnctcnancnngcnncgnntccggcannntctttttcctnnncnncgtatccnacga
gttnnantngtgcgccngggcccgttttcgggcnnnccnccnacncct

Image Files
Disc

d1 (->Large)
Larval GFP

g1 (->Large)

CLOSE