Detailed Information [113397]
 

Strain Information
DGRC Number 113397
Genotype with FlyBase Link w[*] P{w[+mW.hs]=GawB}fend[NP4124] / FM7c
Genotype w* P{w+mW.hs=GawB}fendNP4124 / FM7c
Break points/Insertion Site 8C13
Map Viewer
Related Genes ld14 CG7065 AP-1gamma
Original Number 4124
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP4124

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 233
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression interesting epi stripes (SH, TU), missing lateral expression (SG)
Larval GFP cns, pns
Larval X-gal AP boundary in outside of pouch
Adult GFP muscle? in tibia and body wall.
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Hartman TR, Ventresca EM, Hopkins A, Zinshteyn D, Singh T, O'Brien JA, Neubert BC, Hartman MG, Schofield HK, Stavrides KP, Talbot DE, Riggs DJ, Pritchard C, O'Reilly AM.
Novel tools for genetic manipulation of follicle stem cells in the Drosophila ovary reveal an integrin-dependent transition from quiescence to proliferation.
Genetics (2015) 199(4) 935-57 [PubMed ID = 25680813] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np30285_0807
Strand Plus
Insertion Point 8873932
Chromosome Band X
Flanking Sequence
attttanacgtgcactgaatttangtgtatacttcggtaagcttcggctatcgacgggac
caccttatgttatttcatcatgGTATACGCTGTGCGAAATTACAATTTCGATTTCAGGAG
CCGAACAACCGAAAAACGAGCGTCGCCGTCGAGGGTTAATGCTGCTCTGAACGAAACCAA
CGAAAACAGAGAGCACGCGAGAACCGAATTCGAAACAGAGATAAAAGCAACAACTGCAAC
ATCGCTGGCAACTACAACAAGCGGCAACAACTACTGCAGTGCGAGCAGCCCAGTTAGCTA
TAGCTAGATTTGGCTTGAATGGCGAAGGGCGAGTCCTGCTGACCCAAAATATTGGATAAA
TGCGAGTACTCAGAGTTTGTTTTGTTGCTTTCTTCCTTACATAAATATAAATATATAAGA
TGTTGATAACATGCAGTATTACTATATATTGAAGAAATACTTCAACTGTTAGGGAAATTA
AATATTTCATTTTCAGTTTAGCTGGTAGAAGACATCTATCTAGCTAGCTTTTGGCCTAGT
TCTCGAGCATTCCTATTAGACCCCGACCATCGAACTCGAGCAGCGAACATGCTCGGAACT
GGAACTGGGACAGGTTGCAAGTGGAGTCCTGTGTGGAGTACCCACTTTGGGTGTTTTGTG
TTCTTGTTGTTGTTGNTGGTTGATGTGGGGGGGGGGGGNNNNNNNNNNNNNTTNNTTTTT
TNGGGGGGNNAAAGGNTGNAAANNGGNTNNCCTTNGGCTTCGGCCCTTTTGGGTTGGNAT
TGGNCTGGGGNNTGGGGNANctggcttccccgggttannttttttgnnnattntgggggg
gggnnnaannttaaaacccaaaaccaaanggntttngnttttttcnattcnnnttanant
tnantttnannnnncccnccctnggggnaannncnaannaaaaaaaannggcccgntnnt
tttnnnaanaannnnnaaagcccn

Image Files
Disc

d1 (->Large)

CLOSE