Detailed Information [113424]
 

Strain Information
DGRC Number 113424
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}bib[NP4281] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype w*; P{w+mW.hs=GawB}bibNP4281 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 30F5
Map Viewer
Related Genes CG13130 CG31875 bib HMS-Beagle{}333
Original Number 4281
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP4281

NP line. Received from the National Institute of Genetics.

Original Comments comment1:A, comment2:30F
Balancer CyUW14
Cluster id 1143
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression epi, weak (TU)
Larval GFP no larva
Larval X-gal bib, multi-rings in leg, margin
Adult GFP joint in the leg
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Shirai T, Yorimitsu T, Kiritooshi N, Matsuzaki F, Nakagoshi H.
Notch signaling relieves the joint-suppressive activity of Defective proventriculus in the Drosophila leg.
Dev. Biol. (2007) 312(1) 147-56 [PubMed ID = 17950268] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np31015_0907
Strand Minus
Insertion Point 9977059
Chromosome Band 2L
Flanking Sequence
gaattaatttgtcttcttcggtaagcttcggctctcgacgggaccaccttatgttatttc
atcatgTGCTCGCCGACATCGACGTCCACGGCCCTCAGGAACAAGTTGAAGTTGCAACAC
ANCTCACCACCAACACCACCACCACTATCGCTCGGCGGCGGCAGCGAAACANCTGCCCAC
TCCACCGACGCAGTGGTGGATAAGCAACCCCTGCACTGAGAAATAAATAAGGTGCATTTG
TCACGCAGCAAACGATGGAAATCTGCAAGCAAAAACAACGTTTTAATATCATTATCTTTC
CTATATATATTTTGAACGATATACTTATNTAAACCGNATAAGTAATTTCCAACAACCTAT
ACCTTACTTTATATAAATAATTTTTTTAGNTGCACNACTTTTTAGNNAAAAGNCACATTT
TTATACATTAAAATAACCCNCATAANGATNATTNTTTNAATNTCAAAAATATNTTAGATT
CCCGNAAGGTTTCCCAAAATANTGCCTCAGNGNCCTTTGGGAACCGGNATTGGGAAACCG
AAACCCAGGAGGGTCCCCNGTTNAACCCTNGNNGGGNTTTTAACCCGGCCCTTANNNTTG
AGTTTANNGGCCNTTGGTACCTTTNCCNCCCCCATTTCNGGGCAGGCAATAANTCCATNA
ATTANTTTAAGAGTTGGCTNAAAGGTNNATTTGGGGCCANCCCACTNTNNTTNGNANNGA
ATACCCTNTNNNNGNTNAGNTNCCCCNTGNNNCCAAAGNAAACCCATTTNTTTGGNTGGG
NGNCCCCGTTTTTTCANGNGnaggcaattccntnccnnacnnngnnatnccnttttnagn
nncccancnnaaanntctngtaannggcttncccggggcgnnttanaattcccnngggaa
tngnggggngttnatnatttgatngggcggtcgngatgcatttcgtntcangncnacnng
tccttnggnccgttggnncctacccncttccggtnnnagnnggcgnaacttttttttttn
ctgcctaannnntagagantttagccntngan

Image Files
Disc

d1 (->Large)

d2 (->Large)

d3 (->Large)

d4 (->Large)
Larval GFP

g1 (->Large)

g2 (->Large)

CLOSE