Detailed Information [113517]
 

Strain Information
DGRC Number 113517
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}Fer2LCH[NP4763] / TM3, Sb[1] Ser[1]
Genotype w*; P{w+mW.hs=GawB}Fer2LCHNP4763 / TM3, Sb1 Ser1
Break points/Insertion Site 99F2
Map Viewer
Related Genes Fer2LCH Fer1HCH roo{}1460
Original Number 4763
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP4763

NP line. Received from the National Institute of Genetics.

Balancer TM3 Sb Ser
Cluster id 1688
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Embryonic Expression cns, scattered cells
Larval GFP gut
Larval X-gal sg, mt
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Rosas-Arellano A, Vasquez-Procopio J, Gambis A, Blowes LM, Steller H, Mollereau B, Missirlis F.
Ferritin Assembly in Enterocytes of Drosophila melanogaster.
Int J Mol Sci (2016) 17(2) 27 [PubMed ID = 26861293] [RRC reference]

Redhai S, Pilgrim C, Gaspar P, Giesen LV, Lopes T, Riabinina O, Grenier T, Milona A, Chanana B, Swadling JB, Wang YF, Dahalan F, Yuan M, Wilsch-Brauninger M, Lin WH, Dennison N, Capriotti P, Lawniczak MKN, Baines RA, Warnecke T, Windbichler N, Leulier F, Bellono NW, Miguel-Aliaga I.
An intestinal zinc sensor regulates food intake and developmental growth.
Nature (2020) 580(7802) 263-268 [PubMed ID = 32269334] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np38245_0907
Strand Plus
Insertion Point 26204402
Chromosome Band 3R
Flanking Sequence
gnnnnngggnnggngggnnnnnnnnnangggnnngnggtngtttgntttctctttgtnnn
gganncaacggnnggtcacttaaaccccnaattnttttggctgtncggtaagacttcggc
tatncgacgggnaccaccttatgttatttcatcatgCGTCAGCCTTTTCGGGTGAGTAAA
GAGAGCGCCTCTAAGAGAGAGTGGCTAATCTGTGTTGTTGCTTTTTGTATCTTTGTAAAA
CATAATAATAAAAACAAGCGCTCACGGGCTTTTTCACAGGCAAGAGTAAGTGAAATATAG
ATTGGATGTATTTCTGCACTATCTCAGATTTCGTGAAAATGAACACTTTCCAATTCTTAC
TGCATTACGGCCCTTACATTATTATTTTAAAGATACAAATACAAATTCAAAATTCTATTG
CCTTGTTTAGTATGGCACTACCTAGTTAGGAACCATTAAGACTATGTCATTACTATTGGA
TGTGCTTCTGCTCTCCTATTCTAAGAGTGTGATCTATAANNNCANNTGNGNCCACCGAGC
CAANTGCANNNGTAATGGCCGNCGTGCGGGCNTNGGCCATNTTGGGCCTNANATCCNNNA
NCNCNTTNANACCAACNNAGNCAAGGGGGAGCCACNNCNGCCATATNGNCCANCNCNNNT
AGTGNNGANAGGAAGAACCANCCNNCCTGTCAATCGNTTCAGNCNANTGNNTTNGACCNN
NGCNNNNCTGGCCNTANAAGCCNANGGNANACTGAANNTNTNCTGANGNGNAGGCNANGG
NATANAANCNGNCACNGGNTcanncnnttngggnnnncnnnnnnnngannnnanggggnn
nnnaanttnanctnnnnnaangnnnnaggnnnnnnnnnnncanggnnccnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnn

CLOSE