Detailed Information [113604]
 

Strain Information
DGRC Number 113604
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NTPase[NP5153] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NTPaseNP5153 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 23B7
Map Viewer
Related Genes betaggt-II NTPase lilli
Original Number 5153
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP5153

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1013
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression many tissues
Larval GFP sg, gut
Larval X-gal sh. Not in disc.
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Carre C, Szymczak D, Pidoux J, Antoniewski C.
The histone H3 acetylase dGcn5 is a key player in Drosophila melanogaster metamorphosis.
Mol. Cell. Biol. (2005) 25(18) 8228-38 [PubMed ID = 16135811] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np45485_0912
Strand Minus
Insertion Point 2875745
Chromosome Band 2L
Flanking Sequence
ttttnncgtgcactgaatttanntgtatacttcggtaagcttcggctatcgacgggacna
ccttatgttatttcatcatgGGCCCAACCCTGGTTAACGTTATCGATGAGCCACGGACTC
TGCAGCCCTGGCACATGTTAACGATAAAGCCCGTAAAATAGACCGAAAAAAGAGAAGAAA
TGAAATTCATTGACATTCGCAGAGATAGCAAACAGCCAGCGTGTTAATATTTGAGCAGCA
AACAACTGAAATGTGTTCCGACCAAGAAACCGGCCATGCATAAATGTGGAGCCAGCAGAG
GCAACGGAACGAGCCATGAAATACGAATATAAGCTGGTAGACCCGATGAACTTGGCCAAG
AAAAACACCATCAAATAACTGAGTAGTCGGTCACAAAACTAATTTGTCTTTCGCCTTTTC
AGCTGGCCACGGATGAGAAGCCACCGCGGCGGAAAAGTAGCGgatcgaagaatacataag
agagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggcaagcca
tccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggcataaaa
tccaacggaattggnggagttatcatgatgagctggccgagtcaatcgatacagtcaact
gtctttgaccctttgntactactctcttccgatgatgatgtcgcacttattctatgctgt
ctcaatgnngagcatatagnnctccnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnn

CLOSE