| Strain Information | |
|---|---|
| DGRC Number | 113604 |
| Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=GawB}NTPase[NP5153] / CyO, P{w[-]=UAS-lacZ.UW14}UW14 |
| Genotype | y* w*; P{w+mW.hs=GawB}NTPaseNP5153 / CyO, P{w-=UAS-lacZ.UW14}UW14 |
| Break points/Insertion Site | 23B7 |
| Map Viewer |  |
| Related Genes | betaggt-II NTPase lilli |
| Original Number | 5153 |
| Chromosome | 2 |
| Comments | FlyBase Insertion: P{GawB}NP5153 NP line. Received from the National Institute of Genetics. |
| Balancer | CyUW14 |
| Cluster id | 1013 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Embryonic Expression | many tissues |
| Larval GFP | sg, gut |
| Larval X-gal | sh. Not in disc. |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2020-04-03 |
| Research papers using this strain [Please submit your publication] |
Trombley S, Powell J, Guttipatti P, Matamoros A, Lin X, O'Harrow T, Steinschaden T, Miles L, Wang Q, Wang S, Qiu J, Li Q, Li F, Song Y. Glia instruct axon regeneration via a ternary modulation of neuronal calcium channels in Drosophila. Nat Commun (2023) 14(1) 6490 [PubMed ID = 37838791] [RRC reference] Carre C, Szymczak D, Pidoux J, Antoniewski C. The histone H3 acetylase dGcn5 is a key player in Drosophila melanogaster metamorphosis. Mol Cell Biol (2005) 25(18) 8228-38 [PubMed ID = 16135811] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Stock Request | |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np45485_0912 |
| Strand | Minus |
| Insertion Point | 2875745 |
| Chromosome Band | 2L |
| Flanking Sequence | ttttnncgtgcactgaatttanntgtatacttcggtaagcttcggctatcgacgggacna ccttatgttatttcatcatgGGCCCAACCCTGGTTAACGTTATCGATGAGCCACGGACTC TGCAGCCCTGGCACATGTTAACGATAAAGCCCGTAAAATAGACCGAAAAAAGAGAAGAAA TGAAATTCATTGACATTCGCAGAGATAGCAAACAGCCAGCGTGTTAATATTTGAGCAGCA AACAACTGAAATGTGTTCCGACCAAGAAACCGGCCATGCATAAATGTGGAGCCAGCAGAG GCAACGGAACGAGCCATGAAATACGAATATAAGCTGGTAGACCCGATGAACTTGGCCAAG AAAAACACCATCAAATAACTGAGTAGTCGGTCACAAAACTAATTTGTCTTTCGCCTTTTC AGCTGGCCACGGATGAGAAGCCACCGCGGCGGAAAAGTAGCGgatcgaagaatacataag agagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggcaagcca tccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggcataaaa tccaacggaattggnggagttatcatgatgagctggccgagtcaatcgatacagtcaact gtctttgaccctttgntactactctcttccgatgatgatgtcgcacttattctatgctgt ctcaatgnngagcatatagnnctccnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnn |