Strain Information | |
---|---|
DGRC Number | 113649 |
Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=GawB}shn[NP5250] / CyO, P{w[-]=UAS-lacZ.UW14}UW14 |
Genotype | y* w*; P{w+mW.hs=GawB}shnNP5250 / CyO, P{w-=UAS-lacZ.UW14}UW14 |
Break points/Insertion Site | 47D7 |
Map Viewer | |
Related Genes | CG13230 shn BS{}809 |
Original Number | 5250 |
Chromosome | 2 |
Comments | FlyBase Insertion: P{GawB}shn[NP5250] NP line. Received from the National Institute of Genetics. |
Also known as | P{GawB}NP5250 |
Balancer | CyUW14 |
Cluster id | 673 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Lethality | lethal |
Embryonic Expression | weak stripe |
Larval GFP | fat body |
Larval X-gal | fat body. midgut. humeral disc. not in wing and haltere discs. (s.g.) |
Adult GFP | fat body, haemocyte. |
Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
Last update | 2022-07-01 |
Research papers using this strain [Please submit your publication] |
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np49435_0912 |
Strand | Minus |
Insertion Point | 6269335 |
Chromosome Band | 2R |
Flanking Sequence | cgcgngcgccccgccaggggnnnggggngnnnngttttttggnnnggnatatcttggggg naaaaaccctttttgtngacttcggtaagcttcggctatcgacgggaccaccttttgtta tttcatcatgATTCAGAGTGTGCTCAGCGTGTGTGCTTGTGTGTGCATGTGTGTGGTGTG TGCGAAAAGAAAACGAAGAAGCGACCGAACGAAGCAAAAACAACAAGTAAGAAGCCCAAA GTCGCACTAGTCGACTACAATGTACCCTTGAGTGGCAGTAAAAGTTATTCTTACTACAAA TTACGTATAATTAGTAGGAATAGGCTAAACGTTTTGGCATTCTGCGATTTTGAGTTGAGC ATAACGAAAATATCAGTTCAGAAAATAAGTATATATTAGGAAAGTTGAAGTCTTCATGCC CGAAAAGGNTTTATAAGGCAGTCTATATCCCAGAATATTCGGGTAGTAGCTCCAATAgat cgaagaatacataagagagaacccgncgccaaagaacccattatttgntgggggcccgnt ttcaggaagggcaagccatccgacatgtcatccctcttcagaccaatcaaatccatgaag agcatcccctggggcataaaaancaacggaaatggggagntattaagaagagctggccga gtcaancganaccagcaannggctttgaaccttggtactacntctcttncgaagaagang gcncacctaatctatgccnggcncaaaggtagaggcatatcagtccccactgaagccatn nnnnnnnggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngnnnnnnnngn nnnngnnnnnnnnnnnnnnnnnnnnnnnnnnnggnnnnnnnnnnnnnnnnnnnnnannaa aaannnanaanaa |