| Strain Information | |
|---|---|
| DGRC Number | 113651 |
| Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=GawB}NP5257 / CyO, P{w[-]=UAS-lacZ.UW14}UW14 |
| Genotype | y* w*; P{w+mW.hs=GawB}NP5257 / CyO, P{w-=UAS-lacZ.UW14}UW14 |
| Break points/Insertion Site | 45D4 |
| Map Viewer | ![]() |
| Related Genes | CG13955 wun wun2 |
| Original Number | 5257 |
| Chromosome | 2 |
| Comments | FlyBase Insertion: P{GawB}NP5257 NP line. Received from the National Institute of Genetics. |
| Balancer | CyUW14 |
| Cluster id | 626 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Embryonic Expression | random epidermis, meso. |
| Larval GFP | weak epidermal |
| Larval X-gal | not in discs. (s.g.) |
| Adult GFP | segmental expression in leg, ap stripes in notum, and other. stronger in pupa. |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2020-04-03 |
| Research papers using this strain [Please submit your publication] |
Matsuo E, Seki H, Asai T, Morimoto T, Miyakawa H, Ito K, Kamikouchi A. Organization of projection neurons and local neurons of the primary auditory center in the fruit fly Drosophila melanogaster. J Comp Neurol (2016) 524(6) 1099-164 [PubMed ID = 26762251] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Stock Request | |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np49495_0912 |
| Strand | Plus |
| Insertion Point | 4474942 |
| Chromosome Band | 2R |
| Flanking Sequence | gtnacgtgcctgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccacct tatgttatttcatcatgGGGCAGCGCAACGCTGCTCTGAAATCCGGTGCTTACTTCTTCG TTCGACGTCGAACGGTGCGGACGGTCgatcgaagaatacataagagagaaccgtcgccaa agaacccattattgttggggtccgttttcaggaagggcaagccatccgacatgtcatcct cttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacggaattgtgg agttatcatgatgagctgccgagtcaatcgatacagtcaactgtctttgacctttgttac tactctcttccgatgatgatgtcgcacttattctatgctgtctcaatgttagaggcatat cagtctccactnacatctnnntnnnnngggggggnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn |