Strain Information | |
---|---|
DGRC Number | 114017 |
Genotype with FlyBase Link | w[1118]; P{w[+mW.hs]=GawB}CG14709[NP6649] / TM3, Sb[1] Ser[1] |
Genotype | w1118; P{w+mW.hs=GawB}CG14709NP6649 / TM3, Sb1 Ser1 |
Break points/Insertion Site | 86E14 |
Map Viewer | |
Related Genes | BEST:CK01227 CG6790 G5{}1291 |
Original Number | 6649 |
Chromosome | 3 |
Comments | FlyBase Insertion: P{GawB}NP6649 NP line. Received from the National Institute of Genetics. |
Balancer | TM3, Sb[1] Ser[1] |
Cluster id | 1440 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Embryonic Expression | weak PNS (ch subset, TU), non PNS cells |
Larval GFP | sg tr |
Larval X-gal | sg, humeral, weak epi |
Adult GFP | internal |
Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np01335_0711 |
Strand | Minus |
Insertion Point | 7395009 |
Chromosome Band | 3R |
Flanking Sequence | anncttgggtgcaaacccnttttttgtatacttcggtaagcttcggctatcgacgggacc accttatgttatttcatcatgCCCACGACTATCTGCTCGCTCCGAAGGTCCGACTCGTTC TGACCCgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttgggg tccgttttcaggaagggcaagccatccgacatgtcattntcttcagaccaatcaaatcca tgaagagcatccctgggcataaaatccaacggaattgtggagttatcatgatgagctgcc gagtcaatcgatacagtcaactgtctttgacctttgttactactctcttccgatgatgat gtcgcacttattctatgctgtctcaatgttagaggcatatcagtctccactgagccatct tattattnggggnnnnnnntnntntnnntnnnntnaatnnnnngnangnatannnnnnnn nncacngngntnnaatnnnnnntnnnnnnnannnnnnnnnnnnaannnnnnnnnnnngnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nn |