Detailed Information [114098]

Strain Information
DGRC Number 114098
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}amn[NP7139] / FM7c
Genotype y* w* P{w+mW.hs=GawB}amnNP7139 / FM7c
Break points/Insertion Site 18F4; -; 19A2
Map Viewer
Related Genes amn CG15618 CG32529
Original Number 7139
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP7139

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 472
General Information NP_lines
Embryonic Expression oenocyte
Larval X-gal gut, mt, oenocyte
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Rohwedder A, Wenz NL, Stehle B, Huser A, Yamagata N, Zlatic M, Truman JW, Tanimoto H, Saumweber T, Gerber B, Thum AS.
Four Individually Identified Paired Dopamine Neurons Signal Reward in Larval Drosophila.
Curr. Biol. (2016) 26(5) 661-9 [PubMed ID = 26877086] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np52615_0227
Strand Minus
Insertion Point 19618087
Chromosome Band X
Flanking Sequence
tttcgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccacct
tatgttatttcatcatgGTTTGGGCCAACACTTGTCGCCTCTTGGCCATTATGCAACGAC
AGCGAAACGAAGGTGCTCACGAAGTGGCCAAGCTGCTCTCTGATTGGTCGGCGGTCAGTG
CCACGAGGCCAGCCGAAGTTCTCTCGCGAGAACCCAAGAGCACTCTCTCCCTCTCTTTTG
GGAGAGATGAGATAGCAAAGAAAAGCCAAAACACTAGAACAATCCAGAAGCCAAGTTTTC
CGGCTTGCACATACGCCGTATAATCCGCATTTTTTGCGAACTCTAAACTCGAGTCTATCA
GCTATAATATTACAATTCGTTCACTATAAACAAATAAACTAATATAGTTTTGCTCAGAAA
TCGATGCACTATGATGAGAGAATAGTGAAAAACAATTCTCAGTTAATAGCTTTTAAACTG
CGCTGCAAATGGGAAAACAAATTAAAATATACACATTTTCATGCCAAATAATAGGATATC
CTATCCTTCATTATATAAGCATAAACAATAAAAATATTCTAGCTCGCTTTgatcgaagaa
tacataagagagaaccgtcgccaaagaacccattattgttggggtcccgttttcaggaag
ggcaagccattccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatncct
gggcataaaatccaacgggaatgggggagttttcatgatgagctggccgagtcaatcgat
acagncaactggctttgaccttngntctactctcttccgaggatgatgtcgcacttattc
tatgctggctcaaggtagaggcttttagncncncnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE