Detailed Information [114120]
 

Strain Information
DGRC Number 114120
Genotype with FlyBase Link y[*] P{w[+mW.hs]=GawB}hfw[NP7175] w[*] / FM7c
Genotype y* P{w+mW.hs=GawB}hfwNP7175 w* / FM7c
Break points/Insertion Site 2B5
Map Viewer
Related Genes CG14797 EG:171E4.2 EG:171E4.4
Original Number 7175
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP7175

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 42
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression muscle weak
Larval X-gal sg
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Groschner LN, Chan Wah Hak L, Bogacz R, DasGupta S, Miesenbock G.
Dendritic Integration of Sensory Evidence in Perceptual Decision-Making.
Cell (2018) 173(4) 894-905.e13 [PubMed ID = 29706545] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np25125_0807
Strand Minus
Insertion Point 1426753
Chromosome Band X
Flanking Sequence
ntttntttggggngaaaannncccntttttntgtacttcggtaagcttcggctatcgacg
ggaccaccttatgttatttcatcatgGGTACACCCATACACTAGCAGAGCTGCATGCGCA
TTGGACTTACGTGGGTGTACGCGAGCATGTCGCCTCCGAAATGAATTCCACTAGGTGCTC
CCTGGCAGGTTTACTCCTCGACTAGGTGGCGCGGGAACGGAGCGGTCNTCCACATCCGAG
GAATCGCAATCATACGGAAGTGTTCACAATTTAAATGCTTTGCGCACATCCCAGTCCCAG
CGGAGAGGAGCTACTTTCTGGGCGGTTCTGCAGGCTCGTTCGGTCCGCCAGGTGATCNAA
GAATACATAAGAGAGAACCGTCGCCAAAGAACCCATTATTGTTGGGGTCCGTTTTCAGGA
AGGGCAAGCCATNCGACATGTCATCCTCTTNAGACCAATCAAATCCATGAAGAGCATCCC
TGGGCATAAAATCCAACGGAATTGTGGAGTTATCATGATGAGCTGCCGAGTCAATCGATA
CAGTCAACTGTCTTTGACCTTTGTTACTACTCTCTTNCGATGATGATGTCNCACTTATTC
TATGCTGACTCAATGTTAGAGGCATATCAGNCTCCACTGAGCATNNTTTTTNNTGGGANN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nn

CLOSE