Detailed Information [114200]
 

Strain Information
DGRC Number 114200
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}tlk[NP7281] / FM7c
Genotype y* w* P{w+mW.hs=GawB}tlkNP7281 / FM7c
Original Number 7281
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP7281

NP line. Received from the National Institute of Genetics.

Balancer FM7c
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression sg, scattered cells
Larval X-gal sg, oenocyte
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Lin TY, Luo J, Shinomiya K, Ting CY, Lu Z, Meinertzhagen IA, Lee CH.
Mapping chromatic pathways in the Drosophila visual system.
J Comp Neurol (2016) 524(2) 213-27 [PubMed ID = 26179639] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np18775_0807
Flanking Sequence
antcttttgggggaaaaaacccttttttggggncnnncggaaagccntcggctatcgacg
ggaccaccttatgttatttcatcatgGTCTGCGCTTTGCTTTTTAATAAAACATTACATA
CACACATACAAATGCCGCTGCATTCTGGCTCTCTTTCGCTGCTGTTATTTCCCTCGCACT
CTCGAGCACGCAACGCATGCCGCAGCCGCGCTATTTTNGTCCCGCTCGCACTCGTGCACT
TATTTTGCACATTCTCCTTTGATGCCTNTTCTGTTGCCACCGCTCGGGTTGCCACCTAGT
CGCGATTTCCGAATATCGCGCATGTGGCAGCACTATCTCACCCAAAGCGAAAGAGAGAGC
GAGAGCAACTGCAAAACGAAAGAAGCAGCGGAGCAAAACAAAAGCGGCGTCAGTGTTGCA
AAGTGCATAAAGCAGTCAGTGAGAGACGGAGTGTAAATTATATCCAAAAGCTAAACGAAT
GAAATTNCATCAAAGAAGANAAGAANTAAAAAGAAATCATTTAATGNTGGGGCAAACATA
TATTTCACATCATTCCATACNATAAAATGCATTGAATTGTAGAATTAAAACCATTGGCAG
ACGTAAAAANAAATGTTTATTTTCCAAACAGTTTTGGAGTTTACAACAAAGAAAAATCAA
ANAATTTTAAANAATTTAAGGGATTAACAANNGANTNCGATTTNGCTNGGCAAACCAAAG
AAANTTTAAATNTTCGGAAGGTCCTAATTTTTTTTTTNCGTTTTCNAAGGAATGGNGCGA
AAAAANNGCTTTTTNGAAANgggcnaccggtnctggggccctttaaaaaaacgggccggt
ttnttttaaacaggnttttantaaggtttttaacccaaaacnttnaaaaaaaanttncct
ttgggttggaataaaaananggcccccngggggcccattggnaaagggcccnggaaaaaa
ctttgggcccttaag

CLOSE