Detailed Information [140092]

Strain Information
DGRC Number 140092
Genotype with FlyBase Link y[*] w[*]; PBac{SAstopDsRed}LL00467 P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] bw[1] / CyO, S[*] bw[1]
Genotype y* w*; PBac{SAstopDsRed}LL00467 P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 bw1 / CyO, S* bw1
Break points/Insertion Site 22e1
Related Genes Rab5 (CG3664)
Received Date 19 October 2007
Original Number LL00467
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: 2L:2363019(-)
Cytological Band: 22e1
Gene Symbol-1: Rab5
CG Number-1: CG3664
FlyBase ID-1: FBgn0014010
Insertion Type-1: Intron
Gene Symbol-2:
CG Number-2:
FlyBase ID-2:
Insertion Type-2:
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Lethality lethal
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev. Cell (2008) 14(2) 227-38 [PubMed ID = 18267091] [RRC reference]
Last update 2015-07-16
Research papers using this strain
[Please submit your publication]
Takino K, Ohsawa S, Igaki T.
Loss of Rab5 drives non-autonomous cell proliferation through TNF and Ras signaling in Drosophila.
Dev. Biol. (2014) 395(1) 19-28 [PubMed ID = 25224221] [RRC reference]
Stock Request

Library & Clone Information
Strand Minus
Insertion Point 2363019
Chromosome Band 2L
Flanking Sequence
NNNNNNAANNNNNGNNGNNNNANNTACNCAGANNATCTTTCTAGGGNTAATTTAATAACG
CCGCACAGCGTACATGTTTGTCANGNTTANAAAATTCTCCACGTCTCTCCGTTAATTTAT
TTTGCATNGATTTTTATCACAGCTTCCGCCCTCACTCTGTGNATTCTCTTCGCTCTGCGC
TCACTTCTCTCCACAAAGTAAACAAGACTCGTGNAGAATTCCATACCCCGATCTTCGTAG
ATTTATCTCCACTGTACAGTCTGGCTTCAATGTGTTAATTAATTTCTGTCGGAATTCTGA
GATTCCCGGCGTCGGTCATAAAAACGAAAAGCATGTGAACGATACTTTGTGAAGATTTGA
AAACGACTTTAGCTTACTTAATATATGCAANAGTAAATATTTTTAAACAATTTTAATGAT
TACTCTCTGTTTAAAGCGATATCTTGTTTCGGGATCAACGTATCTGTGGGGGACATCGGA
AAAGNGTA
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.


CLOSE