Strain Information | |
---|---|
DGRC Number | 140400 |
Genotype with FlyBase Link | y[*] w[*]; PBac{SAstopDsRed}LL01535 P{w[+mW.hs]=FRT(w[hs])}2A P{ry[+t7.2]=neoFRT}82B P{y[+t7.7] ry[+t7.2]=Car20y}96E / TM3, Sb[1] |
Genotype | y* w*; PBac{SAstopDsRed}LL01535 P{w+mW.hs=FRT(whs)}2A P{ry+t7.2=neoFRT}82B P{y+t7.7 ry+t7.2=Car20y}96E / TM3, Sb1 |
Break points/Insertion Site | 67B3 |
Related Genes | Hsp23 (CG4463) |
Received Date | 19 October 2007 |
Original Number | LL01535 |
Chromosome | 3 |
Original Source | Liqun Luo, Stanford University |
Original Comments | Location: 3L:9375042(-) Cytological Band: 67B3 Gene Symbol-1: Hsp23 CG Number-1: CG4463 FlyBase ID-1: FBgn0001224 Insertion Type-1: 5' UTR Gene Symbol-2: CG Number-2: FlyBase ID-2: Insertion Type-2: Location coordinates are based on the Drosophila Genome release 5.0. IMPORTANT NOTES: Oren Schuldiner (Weizmann Institute of Science) |
General Information | MARCM |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Reference | Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L. piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning. Dev Cell (2008) 14(2) 227-38 [RRC reference] |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
Pizzo L, Lasser M, Yusuff T, Jensen M, Ingraham P, Huber E, Singh MD, Monahan C, Iyer J, Desai I, Karthikeyan S, Gould DJ, Yennawar S, Weiner AT, Pounraja VK, Krishnan A, Rolls MM, Lowery LA, Girirajan S. Functional assessment of the "two-hit" model for neurodevelopmental defects in Drosophila and X. laevis. PLoS Genet (2021) 17(4) e1009112 [PubMed ID = 33819264] [RRC reference] Kawasaki F, Koonce NL, Guo L, Fatima S, Qiu C, Moon MT, Zheng Y, Ordway RW. Small heat shock proteins mediate cell-autonomous and -nonautonomous protection in a Drosophila model for environmental-stress-induced degeneration. Dis Model Mech (2016) 9(9) 953-64 [PubMed ID = 27483356] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Strand | Minus |
Insertion Point | 9375042 |
Chromosome Band | 3L |
Flanking Sequence | GCATGCGTCAATTTTACGCAGACTATCTTTCTAGGGTTAATAGGTTACTTTCGCTTTAGC TGTTATCGCTTTGGCTTTTTGAATTCAACTGACGCCGGTTGCACGAAAGTGCCGGATATT TATACAACCGCTTGCTGTCGAATTAACCATTGTGGGAACACTAGAACTAGCTAGTTCTAG AGCGGCCGCCACCGCGGTGGAGCTCCAATTCGCCCTATAGTGAGTCGTATTACGTTATCT AGTTAGGCGCGCCTGTGGGACGGAAGAACAGATGAATTAGATATCTATAACAAGAAAATA TATATATAATAAGTTATCACGTAAGTAGAACATGAAATAACAATATAATTATCGTATGAG TTAAATCTTAAAAGTCACGTAAAAGATAATCATGCGTCA |
Sequence Comment | Location coordinates are based on the Drosophila Genome release 5.0. |