Strain Information | |
---|---|
DGRC Number | 140691 |
Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=FRT(w[hs])}2A P{ry[+t7.2]=neoFRT}82B PBac{SAstopDsRed}LL02849 P{y[+t7.7] ry[+t7.2]=Car20y}96E / TM6B, Tb[1] |
Genotype | y* w*; P{w+mW.hs=FRT(whs)}2A P{ry+t7.2=neoFRT}82B PBac{SAstopDsRed}LL02849 P{y+t7.7 ry+t7.2=Car20y}96E / TM6B, Tb1 |
Break points/Insertion Site | 94A1 |
Related Genes | CG6455, mRpL35 (CG13410) |
Received Date | 25 October 2007 |
Original Number | LL02849 |
Chromosome | 3 |
Original Source | Liqun Luo, Stanford University |
Original Comments | Location: 3R:17848395(+) Cytological Band: 94A1 Gene Symbol-1: CG6455 CG Number-1: CG6455 FlyBase ID-1: FBgn0019960 Insertion Type-1: Intron Gene Symbol-2: mRpL35 CG Number-2: CG13410 FlyBase ID-2: FBgn0038923 Insertion Type-2: Putative Promoter. Location coordinates are based on the Drosophila Genome release 5.0. IMPORTANT NOTES: Oren Schuldiner (Weizmann Institute of Science) |
General Information | MARCM |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Lethality | lethal |
Reference | Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L. piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning. Dev Cell (2008) 14(2) 227-38 [RRC reference] |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
Tsai PI, Lin CH, Hsieh CH, Papakyrikos AM, Kim MJ, Napolioni V, Schoor C, Couthouis J, Wu RM, Wszolek ZK, Winter D, Greicius MD, Ross OA, Wang X. PINK1 Phosphorylates MIC60/Mitofilin to Control Structural Plasticity of Mitochondrial Crista Junctions. Mol Cell (2018) 69(5) 744-756.e6 [PubMed ID = 29456190] [RRC reference] Tsai PI, Papakyrikos AM, Hsieh CH, Wang X. Drosophila MIC60/mitofilin conducts dual roles in mitochondrial motility and crista structure. Mol Biol Cell (2017) 28(24) 3471-3479 [PubMed ID = 28904209] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Strand | Plus |
Insertion Point | 17848395 |
Chromosome Band | 3R |
Flanking Sequence | cagactatttttctagggttaaGGAAATTGGCGAGCCCGTTAATACCCCCGCGCCCTTGG TCAACTGGAATTTTGGAGCTTTTCGCCCAATTCCTGGGCTTGGTAGATGACATAACCAGC GCCTCTTGTTGTATTTTCGCCAACCGCTTGTTTGTGGGCGCGCGGGGGTGTGGGGCAACG TGACGATcgaattaaccattgtgggaacactagaac |
Sequence Comment | Location coordinates are based on the Drosophila Genome release 5.0. |