Detailed Information [140728]
 

Strain Information
DGRC Number 140728
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=FRT(w[hs])}2A P{ry[+t7.2]=neoFRT}82B PBac{SAstopDsRed}LL03178 P{y[+t7.7] ry[+t7.2]=Car20y}96E / TM6B, Tb[1]
Genotype y* w*; P{w+mW.hs=FRT(whs)}2A P{ry+t7.2=neoFRT}82B PBac{SAstopDsRed}LL03178 P{y+t7.7 ry+t7.2=Car20y}96E / TM6B, Tb1
Break points/Insertion Site 89E10
Related Genes CG3995, CG5208
Received Date 25 October 2007
Original Number LL03178
Chromosome 3
Original Source Liqun Luo, Stanford University
Original Comments
Location: 3R:12868434(-)
Cytological Band: 89E10
Gene Symbol-1: CG3995
CG Number-1: CG3995
FlyBase ID-1: FBgn0038472
Insertion Type-1: CDS
Gene Symbol-2: CG5208
CG Number-2: CG5208
FlyBase ID-2: FBgn0028470
Insertion Type-2: Putative Promoter.
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) Because second chromosome was never actively selected against, a small percentage of homozygous cn bw flies resulting in white eyes can be present in the population.
2) All third chromosome flies should be yellow[1] due to the insertion at 96E.
3) A small percentage of early insertions (lower LL number) were balanced with TM3, Sb[1] instead of TM6, Tb[1].
4) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Pradhan SJ, Nesler KR, Rosen SF, Kato Y, Nakamura A, Ramaswami M, Barbee SA.
The conserved P body component HPat/Pat1 negatively regulates synaptic terminal growth at the larval Drosophila neuromuscular junction.
J Cell Sci (2012) 125(Pt 24) 6105-16 [PubMed ID = 23097047] [RRC reference]
Stock Request

Library & Clone Information
Strand Minus
Insertion Point 12868434
Chromosome Band 3R
Flanking Sequence
tttacgcagactagctgtctagggttaaTAGCCACGGTCCGCCGCGAAAAGATATAGCCA
CCTGGAGAAGGGTATTCTAACTTGCTTTTTTTCTAACCGCTTGCATTATAAGTTGATTTG
TTTGTAGGCCTTAAAGGACTGGAAGAGGTTTATCCTGAGAAAGGTGGAAAAGAATGAGAT
GCAGAACATGCCTTTTGGCACCAGTCTTACTTCGTCGGAGGAAACAATAGCCACACTGTG
TAGATTAAACGAGGATGTAAGTCAGATTATTATGAAGGTCTCCGACGATGAAATGCATGA
GAATTCCACCACGGAATTTGATGTGGACGAAGTAGAGGATGTGGTCCCGGAAGAAGATGG
TGGCGCCCTTCAGACTTCCGCCGAGTACGTTTACGAACCGGAGGAGAACAAAACGGACAT
TGACCCGCTTTACCTGCAATCTAACAAACGGGCCGCATTGGCCAGCAGTcgaattaacca
ttgtgggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE