Strain Information | |
---|---|
DGRC Number | 140892 |
Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=FRT(w[hs])}2A P{ry[+t7.2]=neoFRT}82B PBac{SAstopDsRed}LL04718 P{y[+t7.7] ry[+t7.2]=Car20y}96E / TM6B, Tb[1] |
Genotype | y* w*; P{w+mW.hs=FRT(whs)}2A P{ry+t7.2=neoFRT}82B PBac{SAstopDsRed}LL04718 P{y+t7.7 ry+t7.2=Car20y}96E / TM6B, Tb1 |
Break points/Insertion Site | 84D10 |
Related Genes | CG34127 |
Received Date | 25 October 2007 |
Original Number | LL04718 |
Chromosome | 3 |
Original Source | Liqun Luo, Stanford University |
Original Comments | Location: ~3R:3411620(-) Cytological Band: 84D10 Gene Symbol-1: CG34127 CG Number-1: CG34127 FlyBase ID-1: FBgn0083963 Insertion Type-1: Intron Gene Symbol-2: CG Number-2: FlyBase ID-2: Insertion Type-2: Location coordinates are based on the Drosophila Genome release 5.0. IMPORTANT NOTES: Oren Schuldiner (Weizmann Institute of Science) |
General Information | MARCM |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Lethality | lethal |
Reference | Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L. piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning. Dev Cell (2008) 14(2) 227-38 [RRC reference] |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
J. Wesley Robinson Genetic and neural behavioural influences on social space in Drosophila melanogaster Doctoral Thesis, Western University, Electronic Thesis and Dissertation Repository. 10652. (2024) [RRC reference] Yost RT, Robinson JW, Baxter CM, Scott AM, Brown LP, Aletta MS, Hakimjavadi R, Lone A, Cumming RC, Dukas R, Mozer B, Simon AF. Abnormal Social Interactions in a Drosophila Mutant of an Autism Candidate Gene: Neuroligin 3. Int J Mol Sci (2020) 21(13) [PubMed ID = 32610435] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Strand | Minus |
Insertion Point | 3411620 |
Chromosome Band | 3R |
Flanking Sequence | CCTTATGGAGCCTTCTCTGTTAGAAGTTACCAACTTTATGTGCTCTTTTTTTCgaattaa ccattgtgggaacactagaac |
Sequence Comment | Location coordinates are based on the Drosophila Genome release 5.0. |