Detailed Information [140892]
 

Strain Information
DGRC Number 140892
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=FRT(w[hs])}2A P{ry[+t7.2]=neoFRT}82B PBac{SAstopDsRed}LL04718 P{y[+t7.7] ry[+t7.2]=Car20y}96E / TM6B, Tb[1]
Genotype y* w*; P{w+mW.hs=FRT(whs)}2A P{ry+t7.2=neoFRT}82B PBac{SAstopDsRed}LL04718 P{y+t7.7 ry+t7.2=Car20y}96E / TM6B, Tb1
Break points/Insertion Site 84D10
Related Genes CG34127
Received Date 25 October 2007
Original Number LL04718
Chromosome 3
Original Source Liqun Luo, Stanford University
Original Comments
Location: ~3R:3411620(-)
Cytological Band: 84D10
Gene Symbol-1: CG34127
CG Number-1: CG34127
FlyBase ID-1: FBgn0083963
Insertion Type-1: Intron
Gene Symbol-2:
CG Number-2:
FlyBase ID-2:
Insertion Type-2:
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) Because second chromosome was never actively selected against, a small percentage of homozygous cn bw flies resulting in white eyes can be present in the population.
2) All third chromosome flies should be yellow[1] due to the insertion at 96E.
3) A small percentage of early insertions (lower LL number) were balanced with TM3, Sb[1] instead of TM6, Tb[1].
4) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
J. Wesley Robinson
Genetic and neural behavioural influences on social space in Drosophila melanogaster
Doctoral Thesis, Western University, Electronic Thesis and Dissertation Repository. 10652. (2024) [RRC reference]

Yost RT, Robinson JW, Baxter CM, Scott AM, Brown LP, Aletta MS, Hakimjavadi R, Lone A, Cumming RC, Dukas R, Mozer B, Simon AF.
Abnormal Social Interactions in a Drosophila Mutant of an Autism Candidate Gene: Neuroligin 3.
Int J Mol Sci (2020) 21(13) [PubMed ID = 32610435] [RRC reference]
Stock Request

Library & Clone Information
Strand Minus
Insertion Point 3411620
Chromosome Band 3R
Flanking Sequence
CCTTATGGAGCCTTCTCTGTTAGAAGTTACCAACTTTATGTGCTCTTTTTTTCgaattaa
ccattgtgggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE