Detailed Information [140948]
 

Strain Information
DGRC Number 140948
Genotype with FlyBase Link y[*] w[*]; PBac{SAstopDsRed}LL06330 P{w[+mW.hs]=FRT(w[hs])}2A P{ry[+t7.2]=neoFRT}82B P{y[+t7.7] ry[+t7.2]=Car20y}96E / TM6B, Tb[1]
Genotype y* w*; PBac{SAstopDsRed}LL06330 P{w+mW.hs=FRT(whs)}2A P{ry+t7.2=neoFRT}82B P{y+t7.7 ry+t7.2=Car20y}96E / TM6B, Tb1
Break points/Insertion Site 64B4
Related Genes Syx17 (CG7452)
Received Date 25 October 2007
Original Number LL06330
Chromosome 3
Original Source Liqun Luo, Stanford University
Original Comments
Location: 3L:4403852(+)
Cytological Band: 64B4
Gene Symbol-1: Syx17
CG Number-1: CG7452
FlyBase ID-1: FBgn0035540
Insertion Type-1: CDS
Gene Symbol-2:
CG Number-2:
FlyBase ID-2: FBgn0035540
Insertion Type-2:
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) Because second chromosome was never actively selected against, a small percentage of homozygous cn bw flies resulting in white eyes can be present in the population.
2) All third chromosome flies should be yellow[1] due to the insertion at 96E.
3) A small percentage of early insertions (lower LL number) were balanced with TM3, Sb[1] instead of TM6, Tb[1].
4) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev. Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Boda A, L?rincz P, Takats S, Csizmadia T, Toth S, Kovacs AL, Juhasz G.
Drosophila Arl8 is a general positive regulator of lysosomal fusion events.
Biochim Biophys Acta Mol Cell Res (2019) 1866(4) 533-544 [PubMed ID = 30590083] [RRC reference]

Takats S, Pircs K, Nagy P, Varga A, Karpati M, Heged?s K, Kramer H, Kovacs AL, Sass M, Juhasz G.
Interaction of the HOPS complex with Syntaxin 17 mediates autophagosome clearance in Drosophila.
Mol Biol Cell (2014) 25(8) 1338-54 [PubMed ID = 24554766] [RRC reference]

Takats S, Nagy P, Varga A, Pircs K, Karpati M, Varga K, Kovacs AL, Heged?s K, Juhasz G.
Autophagosomal Syntaxin17-dependent lysosomal degradation maintains neuronal function in Drosophila.
J Cell Biol (2013) 201(4) 531-9 [PubMed ID = 23671310] [RRC reference]
Stock Request

Library & Clone Information
Strand Plus
Insertion Point 4403852
Chromosome Band 3L
Flanking Sequence
tttacgcagactatctttctagggTTAAACAGGCGGAGGTCTCCATCCAAAGGTTTCAGG
ATGTGGCGGTAGGTTATTTACTATATCTTCTGAAGAGCGGAACTAATTCCTTAACACTCA
TAGGTGCCCCACCATCTGAGCCTACTGAAAAACCATCGCAGCAATATAGAAAAAAGCCTG
GCGCTCGGCGACTGGCAAAAAATCAAAAAGGAGGAACTCAATGCTATGAGGGTCATTAAG
CAGATCAAGAATCTACTTCTGGAAATGGATGCACTGCGAGAAAAAGTACGGGAGGAGGAT
CTGGAACGTTTCGAAttaaccattgtgggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE