Detailed Information [140993]
 

Strain Information
DGRC Number 140993
Genotype with FlyBase Link y[*] w[*]; P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] PBac{SAstopDsRed}LL03079 bw[1] / CyO, S[*] bw[1]
Genotype y* w*; P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 PBac{SAstopDsRed}LL03079 bw1 / CyO, S* bw1
Break points/Insertion Site 47A13
Related Genes psq (CG2368), psq (CG2368)
Received Date 9 November 2007
Original Number LL03079
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: 2R:6471480(-)
Cytological Band: 47A13
Gene Symbol-1: psq
CG Number-1: CG2368
FlyBase ID-1: FBgn0004399
Insertion Type-1: 5' UTR
Gene Symbol-2: psq
CG Number-2: CG2368
FlyBase ID-2: FBgn0004399
Insertion Type-2: Intron.
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality semi lethal
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]		 Lin TH, Bis-Brewer DM, Sheehan AE, Townsend LN, Maddison DC, Zuchner S, Smith GA, Freeman MR.
TSG101 negatively regulates mitochondrial biogenesis in axons.
Proc Natl Acad Sci U S A (2021) 118(20) [PubMed ID = 33972422] [RRC reference]
Stock Request

Library & Clone Information
Strand Minus
Insertion Point 6471480
Chromosome Band 2R
Flanking Sequence 
tctagggttaaGCTCTCTTGCAGAAAAAACTTTTTCTTACTGGTTTTTGATGGTATTTTT
TTTTTTGAAGAAGAATGTATTCCTCGCTTTCAGTACATTTGCTTTTGCTGCACTTCTTGC
GCGTAATTTCGCGACGTTTTGGAAATATTCGTTTCTTTTTTAATTGAAGCAAATcgaatt
aaccattgtgggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE