Detailed Information [141081]
 

Strain Information
DGRC Number 141081
Genotype with FlyBase Link y[*] w[*]; PBac{SAstopDsRed}LL03589 P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] bw[1] / CyO, S[*] bw[1]
Genotype y* w*; PBac{SAstopDsRed}LL03589 P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 bw1 / CyO, S* bw1
Break points/Insertion Site 33F3
Related Genes CG5525, CG6153
Received Date 9 November 2007
Original Number LL03589
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: 2L:12692849(+)
Cytological Band: 33F3
Gene Symbol-1: CG5525
CG Number-1: CG5525
FlyBase ID-1: FBgn0032444
Insertion Type-1: 5' UTR
Gene Symbol-2: CG6153
CG Number-2: CG6153
FlyBase ID-2: FBgn0032445
Insertion Type-2: Putative Promoter.
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]		 Kim AR, Choi KW.
TRiC/CCT chaperonins are essential for organ growth by interacting with insulin/TOR signaling in Drosophila.
Oncogene (2019) 38(24) 4739-4754 [PubMed ID = 30792539] [RRC reference]
Stock Request

Library & Clone Information
Strand Plus
Insertion Point 12692849
Chromosome Band 2L
Flanking Sequence 
tttacgcaggctatctttctagggttaaCAAAACACAGTTATTCTACAATAAATTCACAG
CGATTTACACAGAACACGTTGCTGCGAAATGTTAAGGAAAGTGTGGCCGCACTCGCTGAG
CTCAAATATACCGCCAACTTATCGGCATcgaattaaccattgtgggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE