Detailed Information [141824]
Strain Information
DGRC Number 141824
Genotype with FlyBase Link y[*] w[*]; PBac{SAstopDsRed}LL06553 P{w[+mW.hs]=FRT(w[hs])}2A P{ry[+t7.2]=neoFRT}82B P{y[+t7.7] ry[+t7.2]=Car20y}96E / TM6B, Tb[1]
Genotype y* w*; PBac{SAstopDsRed}LL06553 P{w+mW.hs=FRT(whs)}2A P{ry+t7.2=neoFRT}82B P{y+t7.7 ry+t7.2=Car20y}96E / TM6B, Tb1
Break points/Insertion Site 80D3
Related Genes CG32350, CkIIalpha (CG17520)
Received Date 19 November 2007
Original Number LL06553
Chromosome 3
Original Source Liqun Luo, Stanford University
Original Comments
Location: 3L:23143531(-)
Cytological Band: 80D3
Gene Symbol-1: CG32350
CG Number-1: CG32350
FlyBase ID-1: FBgn0052350
Insertion Type-1: 5' UTR
Gene Symbol-2: CkIIalpha
CG Number-2: CG17520
FlyBase ID-2: FBgn0000258
Insertion Type-2: 3' UTR.
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) Because second chromosome was never actively selected against, a small percentage of homozygous cn bw flies resulting in white eyes can be present in the population.
2) All third chromosome flies should be yellow[1] due to the insertion at 96E.
3) A small percentage of early insertions (lower LL number) were balanced with TM3, Sb[1] instead of TM6, Tb[1].
4) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev. Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-03-12
Research papers using this strain
[Please submit your publication]
Takats S, Pircs K, Nagy P, Varga A, Karpati M, Heged?s K, Kramer H, Kovacs AL, Sass M, Juhasz G.
Interaction of the HOPS complex with Syntaxin 17 mediates autophagosome clearance in Drosophila.
Mol. Biol. Cell (2014) 25(8) 1338-54 [PubMed ID = 24554766] [RRC reference]
Stock Request
---

Library & Clone Information
Strand Minus
Insertion Point 23143531
Chromosome Band 3L
Flanking Sequence
tttacgcagactatctttctagggTTAATAATAGTATCATCGCATAATTATATGAAACTA
TTGACAGAATGGATATAAGTGTCTTTGAATGGAAGAAAGTGGATCTTTTCAATATAATCG
TCGTACCATTTGTAAAAATTCCGAACACGGCAGAAATATCGTGCTACTGCTTTCCCGAAT
CAAAATCAAGCACTGAGGAAAGAAATATAAAATTAGTAATTTGTGATAAGAACAGAAATA
TTCTTATTTACCTTTCAAATTGGGAGTGTATTACCTTCAAATCTCCATCCACGCGGAAAG
CTATTGCTCTTTGTTCCCTTACCAGCAATAACAGCCTTGCGACTGTCACACCGGATATCA
ATAATGGTATTCACATTGATATATTTGACCTTAATAGATTAACAAAAAAGCAAGCAGCTC
CAATAATTGCATCTGCATATACTCAGCCTTCAAGTACGCCCTTATGCCTCAACGCAGACG
TCATTGACGATAAATTGTTTGCGTTGGCGATAGGATTGGGAAATGGTGATATTCTTTTGC
ATTATGGAAAAATCACAAAAAATTTTTCTGCAAATATTCGCCAACATACTGTTTCTGGAA
ACGCAGTCAATGGAATACATTTTGATTTCAAAACACAACCTTTAGATACAACTCAAATAA
TGTTTGTGACATGTGTTCAAAGGAGTTTATTGTTTTATGTTAAAAGAGAAATGCATAATG
GATACAAATTTGTACTTGATAATGATAAAGGTAATCTTAATACCGCAGTATAATGTGCAA
GCTGAGTGGCCGAAATAAATGGATCATGGTGTGTGGGACGGCAGACGCCTGTTTTATTGC
CTACACCTTCC
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE