Detailed Information [141970]
 

Strain Information
DGRC Number 141970
Genotype with FlyBase Link y[*] w[*]; PBac{SAstopDsRed}LL07138 P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] bw[1] / CyO, S[*] bw[1]
Genotype y* w*; PBac{SAstopDsRed}LL07138 P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 bw1 / CyO, S* bw1
Break points/Insertion Site 40
Related Genes lt (CG18028), lt (CG18028)
Received Date 11 December 2008
Original Number LL07138
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: 2L:22817763(-)
Cytological Band: 40
Gene Symbol-1: lt
CG Number-1: CG18028
FlyBase ID-1: FBgn0002566
Insertion Type-1: 5' UTR
Gene Symbol-2: lt
CG Number-2: CG18028
FlyBase ID-2: FBgn0002566
Insertion Type-2: CDS
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]		 L?rincz P, Kenez LA, Toth S, Kiss V, Varga A, Csizmadia T, Simon-Vecsei Z, Juhasz G.
Vps8 overexpression inhibits HOPS-dependent trafficking routes by outcompeting Vps41/Lt.
Elife (2019) 8 [PubMed ID = 31194677] [RRC reference]

Boda A, L?rincz P, Takats S, Csizmadia T, Toth S, Kovacs AL, Juhasz G.
Drosophila Arl8 is a general positive regulator of lysosomal fusion events.
Biochim Biophys Acta Mol Cell Res (2019) 1866(4) 533-544 [PubMed ID = 30590083] [RRC reference]
Stock Request

Library & Clone Information
Strand Minus
Insertion Point 22817763
Chromosome Band 2L
Flanking Sequence 
tttacgcagactatctttctagggTTAAATTTGGGCTCCACATCTTCCTCATTTATGCTA
TCGGCCCAAGAGTCCTGGAATGAACAAAAGTTTAATAACATGCGTTTAGCAAAGCATCCA
CAAATCATACACAACTGATGAGCGGCAACGCTTTAGCCATTTAAAGCAAACGGAAATTTC
TTATTTTCAAACAACGAAAATACACAAGCTGATGTATTATTTTATTATTTACATTTACTA
ATAGCGCCATAGACAATAATAATTACTATAAAACGGTCTTATTATTCGAAttaaccattg
tgggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE