Detailed Information [142132]
 

Strain Information
DGRC Number 142132
Genotype with FlyBase Link y[*] w[*]; PBac{SAstopDsRed}LL07771 P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] bw[1] / CyO, S[*] bw[1]
Genotype y* w*; PBac{SAstopDsRed}LL07771 P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 bw1 / CyO, S* bw1
Break points/Insertion Site 35F1
Related Genes PRL-1 (CG4993)
Received Date 11 December 2008
Original Number LL07771
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: 2L:16249074(-)
Cytological Band: 35F1
Gene Symbol-1: PRL-1
CG Number-1: CG4993
FlyBase ID-1: FBgn0024734
Insertion Type-1: 5' UTR
Gene Symbol-2:
CG Number-2:
FlyBase ID-2:
Insertion Type-2:
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Kula-Eversole E, Lee DH, Samba I, Yildirim E, Levine DC, Hong HK, Lear BC, Bass J, Rosbash M, Allada R.
Phosphatase of Regenerating Liver-1 Selectively Times Circadian Behavior in Darkness via Function in PDF Neurons and Dephosphorylation of TIMELESS.
Curr Biol (2021) 31(1) 138-149.e5 [PubMed ID = 33157022] [RRC reference]
Stock Request

Library & Clone Information
Strand Minus
Insertion Point 16249074
Chromosome Band 2L
Flanking Sequence
tttacgcagactatctttctagggTTAAAAGAAACCAATCAAATCTTTGAGAAAACGAAA
CAAAAACCACACCTCAAGATTGTAAGAAAACAGACTTAAGTGCACACGAGCCAGATTAAG
TCCTTCAGAACAGCTTTTGTAATTGTTTATGAGCATCACCATGCGTCAAAAAGATCTGCG
CCCAGCGCCCGCTCTAATTGAGTACAAGGGCATGAAGTTCCTAATCACCGATCGAAttaa
ccattgtgggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE