Detailed Information [200063]
 

Strain Information
DGRC Number 200063
Genotype with FlyBase Link y[1] w[67c23] P{w[+mC]=GSV1}GS1026 / Binsinscy
Genotype y1 w67c23 P{w+mC=GSV1}GS1026 / Binsinscy
Break points/Insertion Site 1D1
Map Viewer
Related Genes CG3026(CT10194)
Received Date 1/28/03
Original Number 1026
Comments Received from Tokyo Metropolitan University.
Original Comments Vector: GSV1
Location (tagged genes): 5'UTR
Function / Process (tagged genes): ?
General Information GS_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Barclay SS, Tamura T, Ito H, Fujita K, Tagawa K, Shimamura T, Katsuta A, Shiwaku H, Sone M, Imoto S, Miyano S, Okazawa H.
Systems biology analysis of Drosophila in vivo screen data elucidates core networks for DNA damage repair in SCA1.
Hum. Mol. Genet. (2014) 23(5) 1345-64 [PubMed ID = 24179173] [RRC reference]

Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [PubMed ID = 9927464] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name GSV1
Insertion Point 797899 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Flanking Sequence
AAAAACAAGCGTGCAGAGGCAGTGTGACCGTCCTATGGAAAGTGTGCTCTTTGCGCCGCC
TGAATTCGCTTCAGATACCAACAAACATCAGCTGTTGTTGCTGCTTTTTATCCTGCGTGG
AAACATGTCGGCCATTACATAGTTAACACACTCCCTTAATCGCAGCAGCCTTCGTGGAAT
CACACATCTTCAGTTTTGCCAGTTCAGTTTTTGCTTGCCCGCCAAAAAAACAAATCAAAA
AAAAATACCGAAGAG
Sequence Comment X:797600..797899dmel-X-chromosome-r4.1.1.fasta. 5' upstream sequence from genome annotation release 4.1.1. This is not raw data.

Library Name / Clone Name GSV1
Insertion Point 797899 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Flanking Sequence
CTAGTTGTACAGTAATAAAAATGCCACCACCAGAAGCCGGCAATTGAAGCGCGTTTATTT
GCCGTGCATTAGTTTTATTATTTGGCATTGTTTTACATAATAAAAGTTGTGAAGCAATGG
AGACCCGACTGGAAGTGCTCTTGCGGGAGCCGAATCCATTGTTCACCCGTTGGCTGGAGC
GCTGGCTGCGCGAAGCGGAGCGCCGAGAACAGAAGTCCCAGTTTAGCCTGCGCCAGGCGT
TGGAGTCCCTAAAAAGCTACCCTCTGCCATTGGCCAGCGGACGAGACTGTTCCATTCTGC
Sequence Comment X:797899..798198dmel-X-chromosome-r4.1.1.fasta. 3' downstream sequence from genome annotation release 4.1.1. This is not raw data.

CLOSE