Detailed Information [200852]
 

Strain Information
DGRC Number 200852
Genotype with FlyBase Link w[*]; P{w[+mC]=GSV3}GS6029 / TM3, Sb[1] Ser[1]
Genotype w*; P{w+mC=GSV3}GS6029 / TM3, Sb1 Ser1
Break points/Insertion Site 85D22
Map Viewer
Related Genes CG9373(CT26621)
Received Date 1/22/03
Original Number 6029
Comments Received from Tokyo Metropolitan University.
Original Comments Vector: GSV3
Location (tagged genes): Intron
Function / Process (tagged genes): RNA binding
General Information GS_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [RRC reference]
Last update 2022-02-15
Research papers using this strain
[Please submit your publication]		 Ustaoglu P, Haussmann IU, Liao H, Torres-Mendez A, Arnold R, Irimia M, Soller M.
Srrm234, but not canonical SR and hnRNP proteins, drive inclusion of Dscam exon 9 variable exons.
RNA (2019) 25(10) 1353-1365 [PubMed ID = 31292260] [RRC reference]

Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [PubMed ID = 9927464] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name GSV3
Insertion Point 5335802 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Flanking Sequence 
AACAGATCCTTCAGATCCTGCCAACGGTAGTCGTATGGAATGTTCGAAATGTAGACCCGG
CAATTGCGACGTTCCCGGCTACGGTCGCGAGCAGCGACGCCACCTCCCTGACTACCAGCG
CCGTTTCCATTGCCATCAGCGTCCGTGAAACGGGAGCCACGTGCTCCGCGTCCACGACGG
TCGCGCTCCTTCTCGCGGCTCTCCACCGAGTTACTAGCGTCCATGCTCATTGTTGTCTGC
AAGGGATTCGCAATG
Sequence Comment 3R:5335503..5335802dmel-3R-chromosome-r4.1.1.fasta. 5' upstream sequence from genome annotation release 4.1.1. This is not raw data.

Library Name / Clone Name GSV3
Insertion Point 5335802 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Flanking Sequence 
CGGCGTCCGCGAAAACAAAATGGCGACCGCGTCAATCGACTTTTTCGCCAAATGTTCTTT
TCTATGCTAGCGTTATGGCTTACCTTTTGATGTTGGCTGTGCTCTTAATACTGGTAATAT
TTCTATTTTGCTGCTTTCGGCGTAGTAAATTTTATACAATGAACAAACGCTTGTGACAAA
CTACAGTTTCCGAGATCAATAGAAAACCGTACAAAAGTCTATGTTAGAGTTGACAGTGAT
ACGATGACAGCACATTCATCGATGGTTTGATATTTGGACGTGTCTCAGATTTCTATCGAC
Sequence Comment 3R:5335802..5336101dmel-3R-chromosome-r4.1.1.fasta. 3' downstream sequence from genome annotation release 4.1.1. This is not raw data.

CLOSE