| Strain Information | |
|---|---|
| DGRC Number | 201401 |
| Genotype with FlyBase Link | y[1] w[67c23]; P{w[+mC]=GSV3}twin[GS8115] / TM3, Sb[1] Ser[1] |
| Genotype | y1 w67c23; P{w+mC=GSV3}twinGS8115 / TM3, Sb1 Ser1 |
| Break points/Insertion Site | 95E6 |
| Map Viewer | ![]() |
| Received Date | 2/12/03 |
| Original Number | 8115 |
| Comments | Received from Tokyo Metropolitan University. |
| Original Comments | Vector: GSV3 Location (tagged genes): Function / Process (tagged genes): |
| General Information | GS_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Reference | Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T. The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster. Genetics (1999) 151(2) 725-37 [RRC reference] |
| Last update | 2022-02-15 |
| Research papers using this strain [Please submit your publication] |
Pradhan SJ, Nesler KR, Rosen SF, Kato Y, Nakamura A, Ramaswami M, Barbee SA. The conserved P body component HPat/Pat1 negatively regulates synaptic terminal growth at the larval Drosophila neuromuscular junction. J Cell Sci (2012) 125(Pt 24) 6105-16 [PubMed ID = 23097047] [RRC reference] Zaessinger S, Busseau I, Simonelig M. Oskar allows nanos mRNA translation in Drosophila embryos by preventing its deadenylation by Smaug/CCR4. Development (2006) 133(22) 4573-83 [PubMed ID = 17050620] [RRC reference] Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T. The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster. Genetics (1999) 151(2) 725-37 [PubMed ID = 9927464] [RRC reference] |
| Stock Request | |
| Library & Clone Information |
|---|
| Library Name / Clone Name | GSV3 |
| Insertion Point | 20032277 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421) |
| Flanking Sequence | AATGGCGGTCAAGTGGTTTTTACAGGGTACTGCCCAAGTCCACAATCCCACGGTGTATTT TCGCTCCACTTCCTCTTCCCACATTACGATTCGGCATGCTCCACTAAATCGGCAAACGTT ATGGGAATCGATGACGCCGCGATGCGTTTAAAATGCATTACAAAGCACAAAGTTGTCATA AAAATTAAATTAAATAAATGCCGAAAACGAGAAGACTTACGTATGATCAAGGGGACGGGA GGTGGCAGGAGATCA |
| Sequence Comment | 3R:20031978..20032277dmel-3R-chromosome-r4.1.1.fasta. 5' upstream sequence from genome annotation release 4.1.1. This is not raw data. |
| Library Name / Clone Name | GSV3 |
| Insertion Point | 20032277 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421) |
| Flanking Sequence | CAATAATCGCAGCAGCATCGTATGCAGCGCACACACAAAACGATCGTCATCGGCCAGAAA AACGGAAAAAAATAAGGCAGTGGTAGTAACAATAATAAAGCTCAGACGAGTCGAGTTATA AACCTACATAGAGCGGCAAAATTTGTACAACCAACGGTGGGCCACTGCGAGTGGCAAGCG GAAAAAAGTCAGAAACAGAAAAAAAAAATTAATTCATGTTGTGCCCATTTCGTGAGCGGA CACAAAAAAAAAGGTTAAAAAAAAAGATGAGGAAGAATAAGTTACAACAAGAAGCAATGG |
| Sequence Comment | 3R:20032277..20032576dmel-3R-chromosome-r4.1.1.fasta. 3' downstream sequence from genome annotation release 4.1.1. This is not raw data. |