Detailed Information [201401]
 

Strain Information
DGRC Number 201401
Genotype with FlyBase Link y[1] w[67c23]; P{w[+mC]=GSV3}twin[GS8115] / TM3, Sb[1] Ser[1]
Genotype y1 w67c23; P{w+mC=GSV3}twinGS8115 / TM3, Sb1 Ser1
Break points/Insertion Site 95E6
Map Viewer
Received Date 2/12/03
Original Number 8115
Comments Received from Tokyo Metropolitan University.
Original Comments Vector: GSV3
Location (tagged genes):
Function / Process (tagged genes):
General Information GS_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [RRC reference]
Last update 2022-02-15
Research papers using this strain
[Please submit your publication]
Pradhan SJ, Nesler KR, Rosen SF, Kato Y, Nakamura A, Ramaswami M, Barbee SA.
The conserved P body component HPat/Pat1 negatively regulates synaptic terminal growth at the larval Drosophila neuromuscular junction.
J Cell Sci (2012) 125(Pt 24) 6105-16 [PubMed ID = 23097047] [RRC reference]

Zaessinger S, Busseau I, Simonelig M.
Oskar allows nanos mRNA translation in Drosophila embryos by preventing its deadenylation by Smaug/CCR4.
Development (2006) 133(22) 4573-83 [PubMed ID = 17050620] [RRC reference]

Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [PubMed ID = 9927464] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name GSV3
Insertion Point 20032277 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Flanking Sequence
AATGGCGGTCAAGTGGTTTTTACAGGGTACTGCCCAAGTCCACAATCCCACGGTGTATTT
TCGCTCCACTTCCTCTTCCCACATTACGATTCGGCATGCTCCACTAAATCGGCAAACGTT
ATGGGAATCGATGACGCCGCGATGCGTTTAAAATGCATTACAAAGCACAAAGTTGTCATA
AAAATTAAATTAAATAAATGCCGAAAACGAGAAGACTTACGTATGATCAAGGGGACGGGA
GGTGGCAGGAGATCA
Sequence Comment 3R:20031978..20032277dmel-3R-chromosome-r4.1.1.fasta. 5' upstream sequence from genome annotation release 4.1.1. This is not raw data.

Library Name / Clone Name GSV3
Insertion Point 20032277 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Flanking Sequence
CAATAATCGCAGCAGCATCGTATGCAGCGCACACACAAAACGATCGTCATCGGCCAGAAA
AACGGAAAAAAATAAGGCAGTGGTAGTAACAATAATAAAGCTCAGACGAGTCGAGTTATA
AACCTACATAGAGCGGCAAAATTTGTACAACCAACGGTGGGCCACTGCGAGTGGCAAGCG
GAAAAAAGTCAGAAACAGAAAAAAAAAATTAATTCATGTTGTGCCCATTTCGTGAGCGGA
CACAAAAAAAAAGGTTAAAAAAAAAGATGAGGAAGAATAAGTTACAACAAGAAGCAATGG
Sequence Comment 3R:20032277..20032576dmel-3R-chromosome-r4.1.1.fasta. 3' downstream sequence from genome annotation release 4.1.1. This is not raw data.

CLOSE